Beefy Boxes and Bandwidth Generously Provided by pair Networks
Don't ask to ask, just ask
 
PerlMonks  

Re^5: Urgent help required. Need a code to translate a given nucleotide sequence into proteins using codon table.

by tmharish (Friar)
on Feb 14, 2013 at 14:18 UTC ( #1018733=note: print w/replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    use strict;
    use warnings ;
    ...
    }
    
    exit() ;
    
  2. or download this
    ATGCATATATATGCTAA
    ATGGCATATATATACGTACGTATGCATATATATGCTAA
    ATGCTAA
    ATGCATGGCATATATATACGTACGTATGCATATATATGCTAA
    

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1018733]
help
Chatterbox?
[1nickt]: Corion I feel that way a lot when I look at the news...
[1nickt]: Brethren, I just noticed in the CPAN ticker Retry, which led me to Attempt, by Mark Fowler. Does anyone have experience with either of these utilities?
[Corion]: No. Back when I toyed with the idea, I found that writing the loop explicitly was usually less code than passing the configuration+ callback to the retrier...

How do I use this? | Other CB clients
Other Users?
Others wandering the Monastery: (7)
As of 2017-05-24 12:34 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?