Beefy Boxes and Bandwidth Generously Provided by pair Networks
We don't bite newbies here... much
 
PerlMonks  

Re^5: Urgent help required. Need a code to translate a given nucleotide sequence into proteins using codon table.

by tmharish (Friar)
on Feb 14, 2013 at 14:18 UTC ( #1018733=note: print w/ replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    use strict;
    use warnings ;
    ...
    }
    
    exit() ;
    
  2. or download this
    ATGCATATATATGCTAA
    ATGGCATATATATACGTACGTATGCATATATATGCTAA
    ATGCTAA
    ATGCATGGCATATATATACGTACGTATGCATATATATGCTAA
    

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1018733]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others studying the Monastery: (11)
As of 2015-03-31 22:09 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    When putting a smiley right before a closing parenthesis, do you:









    Results (673 votes), past polls