Beefy Boxes and Bandwidth Generously Provided by pair Networks vroom
Problems? Is your data what you think it is?
 
PerlMonks  

Comparing and getting information from two large files and appending it in a new file

by perlkhan77 (Acolyte)
on Mar 30, 2012 at 22:37 UTC ( #962693=perlquestion: print w/ replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    #    Chromosome    Gene    Feature    Start    END    Strand    CG_cou
    +nt    CHG_Count    CHH_count    Total_meth_count    C_count    Sequen
    +ce
    #Gm10    Glyma13g27990.1    CDS_1    31097691    31097752    +    1   
    + 1    6    8    9    TTAAGGAAATTATAAATCAAAAAATCAAATTTGACTCGTCACTGGAGT
    +ACTTGTCCATTTGG
    
  2. or download this
    assembly    position    strand    class    mc    h
    10    8691    +    CG    12    12
    ...
    10    8718    -    CG    6    6
    10    8984    +    CG    7    7
    10    8991    +    CG    6    9
    
  3. or download this
     
    %methhash = ();
    use Benchmark;
    ...
        $t1 = Benchmark->new;
    $td = timediff($t1, $t0);
    print "the code took:",timestr($td),"\n";
    

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: perlquestion [id://962693]
Approved by sundialsvc4
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others musing on the Monastery: (5)
As of 2014-04-19 21:19 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    April first is:







    Results (483 votes), past polls