Beefy Boxes and Bandwidth Generously Provided by pair Networks
Syntactic Confectionery Delight
 
PerlMonks  

Comparing and getting information from two large files and appending it in a new file

by perlkhan77 (Acolyte)
on Mar 30, 2012 at 22:37 UTC ( #962693=perlquestion: print w/ replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    #    Chromosome    Gene    Feature    Start    END    Strand    CG_cou
    +nt    CHG_Count    CHH_count    Total_meth_count    C_count    Sequen
    +ce
    #Gm10    Glyma13g27990.1    CDS_1    31097691    31097752    +    1   
    + 1    6    8    9    TTAAGGAAATTATAAATCAAAAAATCAAATTTGACTCGTCACTGGAGT
    +ACTTGTCCATTTGG
    
  2. or download this
    assembly    position    strand    class    mc    h
    10    8691    +    CG    12    12
    ...
    10    8718    -    CG    6    6
    10    8984    +    CG    7    7
    10    8991    +    CG    6    9
    
  3. or download this
     
    %methhash = ();
    use Benchmark;
    ...
        $t1 = Benchmark->new;
    $td = timediff($t1, $t0);
    print "the code took:",timestr($td),"\n";
    

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: perlquestion [id://962693]
Approved by sundialsvc4
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others chilling in the Monastery: (8)
As of 2015-07-31 23:49 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









    Results (282 votes), past polls