Beefy Boxes and Bandwidth Generously Provided by pair Networks
laziness, impatience, and hubris
 
PerlMonks  

Comparing and getting information from two large files and appending it in a new file

by perlkhan77 (Acolyte)
on Mar 30, 2012 at 22:37 UTC ( #962693=perlquestion: print w/ replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    #    Chromosome    Gene    Feature    Start    END    Strand    CG_cou
    +nt    CHG_Count    CHH_count    Total_meth_count    C_count    Sequen
    +ce
    #Gm10    Glyma13g27990.1    CDS_1    31097691    31097752    +    1   
    + 1    6    8    9    TTAAGGAAATTATAAATCAAAAAATCAAATTTGACTCGTCACTGGAGT
    +ACTTGTCCATTTGG
    
  2. or download this
    assembly    position    strand    class    mc    h
    10    8691    +    CG    12    12
    ...
    10    8718    -    CG    6    6
    10    8984    +    CG    7    7
    10    8991    +    CG    6    9
    
  3. or download this
     
    %methhash = ();
    use Benchmark;
    ...
        $t1 = Benchmark->new;
    $td = timediff($t1, $t0);
    print "the code took:",timestr($td),"\n";
    

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: perlquestion [id://962693]
Approved by sundialsvc4
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others contemplating the Monastery: (9)
As of 2014-09-22 06:44 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    How do you remember the number of days in each month?











    Results (182 votes), past polls