Beefy Boxes and Bandwidth Generously Provided by pair Networks
laziness, impatience, and hubris
 
PerlMonks  

Re^3: Comparing and getting information from two large files and appending it in a new file

by graff (Chancellor)
on Mar 31, 2012 at 23:21 UTC ( #962807=note: print w/ replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    
    #!/usr/bin/perl
    ...
    my $t1 = Benchmark->new;
    my $td = timediff($t1, $t0);
    print "the code took:",timestr($td),"\n";
    
  2. or download this
    
     Gm10   Glyma10g00200.1 CDS_11  8569    8705    -       2       2     
    +  6       10      14      GAAGAACCAAAATCGCTGATTTTGAAAAATAGGGGGACTGAAT
    +GTCTTGATTTGGAAATAGGGGGACCAAAATTGCGGATTGAGCATTATAGGGGACCAATAGTGTATTTTA
    +GCCTTTATTTTATTTTGAATGTGTG
    ...
     Gm10   Glyma10g00210.1 CDS_4   18046   19077   -       12      42    
    +  91      145     173     GCGCAACTGTGAAGCTTTAATGCTGCTTCAGAAGAATGGTTTA
    +CGAAAGAAGAATCCTTCAATTTCTGTTGTTGCTACACTGTTTGGAGATGGGGAAGATGTTGCATGGCTT
    +GAGAAAAATCATTTGGCTGACTGGGCAGAAGAAAAATTGGATGGAAGATTAGGAAATGAAACCTTTGAT
    +GATTCTCAGTGGAGAGCAATTGCAATGGGTTTGAATAAAAAGAGGCCTGTATTGGTTATCCAAGGCCCT
    +CCTGGTACAGGCAAGACTGGTTTGCTCAAGCAACTTATAGCATGTGCTGTTCAGCAAGGTGAAAGGGTT
    +CTTGTTACAGCACCTACTAATGCAGCTGTTGATAACATGGTAGAAAAGCTTTCAAATGTTGGATTAAAT
    +ATAGTGCGGGTTGGAAATCCAGCTCGTATATCAAAAACAGTGGGATCAAAGTCTTTGGAAGAAATTGTA
    +AATGCTAAGCTTGCAAGTTTTCGAGAAGAGTATGAGAGGAAGAAGTCAGATCTAAGAAAAGATCTAAGA
    +CATTGTTTAAGGGATGATTCACTAGCTTCAGGCATACGCCAACTTCTGAAGCAACTGGGAAGGTCACTG
    +AAGAAAAAGGAAAAGCAGACCGTAATTGAAGTTCTGTCTAGTGCTCAAGTTGTGGTTGCCACTAATACT
    +GGAGCAGCTGACCCTTTGGTTCGAAGGCTAGATACCTTTGATTTGGTTGTCATAGATGAAGCGGGACAG
    +GCAATTGAACCCTCTTGCTGGATTCCTATATTGCAGGGAAAGCGCTGCATTCTTGCTGGTGATCAATGC
    +CAACTTGCTCCTGTCATATTATCTAGAAAGGCCTTAGAAGTTGGTCTAGGAATATCTCTACTGGAGAGA
    +GCTGCAACTTTGCATGAAGGGATTCTCACCACTAGGTTAACAACACAATACCGTATGAATGATGCAATT
    +GCTAGTTGGGCTTCAAAGGAGATGTACGGAGGATTATTGAAGTCCTCTGAGACTGTCTTTTCTCATCTT
    +CTAGTAGACTCTCCTTTTGTTAA
     Gm10   Glyma10g00210.1 CDS_3   21109   21392   -       4       8     
    +  30      42      52      GGACTTGGGGGAATGCATTTGGTGTTATTCAAGGTTGAAGGGA
    +ACCACCGGTTACCACCAACCACTCTTTCACCTGGAGACATGGTTTGTGTGAGAACATATGACAGCATGG
    +GTGCAATTACAACTTCTTGCATACAAGGATTTGTGAACAGTTTTGGGGATGATGGCTATAGTATTACAG
    +TTGCTTTAGAGTCACGCCATGGTGATCCTACATTCTCTAAACTATTTGGGAAGAGTGTGCGCATTGACC
    +GTATTCAAGGACTGGCTGATACACTTACTTATGA
     Gm10   Glyma10g00210.1 CDS_2   24354   24662   -       9       13    
    +  32      54      66      GCTCAGCATAGGGCGGTTGTGAGAAAGATAACGCAACCCAAGA
    +GTGTCCAAGGCGTTTTAGGAATGGACTTCGAAAAGGTCAAAGCATTACAGCACAGGATTGACGAATTCA
    +CCACCCATATGTCAGAACTACTCCGTATTGAAAGGGATGCTGAGTTGGAGTTTACTCAGGAGGAATTGG
    +ATGCTGTTCCTAAACCAGATGATACTTCTGATTCTTCAAAAACGATTGATTTCTTGGTTAGCCATAGCC
    +AGCCTCAACAAGAACTCTGCGACACCATTTGTAATTTAAACGCTATCAGTACCTCTACA
    
  3. or download this
    assembly        position        strand  class   mc      h
    10      8691    +       CG      12      12
    ...
    10      8718    -       CG      6       6
    10      8984    +       CG      7       7
    10      8991    +       CG      6       9
    
  4. or download this
    Chromosome      Gene    Feature Start   END     CG_count_by_C   CHG_co
    +unt_by_C  CHH_count_by_C
     Gm10   Glyma10g00200.1 CDS_11  8569    8705    0.143   0.071   0.000
     Gm10   Glyma10g00200.1 CDS_9   8885    9079    0.040   0.000   0.000
     Gm10   Glyma10g0test.1 CDS_11  8569    8705    0.143   0.071   0.000
    

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://962807]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others imbibing at the Monastery: (13)
As of 2015-07-31 13:43 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









    Results (277 votes), past polls