Beefy Boxes and Bandwidth Generously Provided by pair Networks RobOMonk
We don't bite newbies here... much
 
PerlMonks  

Re^3: Comparing and getting information from two large files and appending it in a new file

by graff (Chancellor)
on Mar 31, 2012 at 23:21 UTC ( #962807=note: print w/ replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    
    #!/usr/bin/perl
    ...
    my $t1 = Benchmark->new;
    my $td = timediff($t1, $t0);
    print "the code took:",timestr($td),"\n";
    
  2. or download this
    
     Gm10   Glyma10g00200.1 CDS_11  8569    8705    -       2       2     
    +  6       10      14      GAAGAACCAAAATCGCTGATTTTGAAAAATAGGGGGACTGAAT
    +GTCTTGATTTGGAAATAGGGGGACCAAAATTGCGGATTGAGCATTATAGGGGACCAATAGTGTATTTTA
    +GCCTTTATTTTATTTTGAATGTGTG
    ...
     Gm10   Glyma10g00210.1 CDS_4   18046   19077   -       12      42    
    +  91      145     173     GCGCAACTGTGAAGCTTTAATGCTGCTTCAGAAGAATGGTTTA
    +CGAAAGAAGAATCCTTCAATTTCTGTTGTTGCTACACTGTTTGGAGATGGGGAAGATGTTGCATGGCTT
    +GAGAAAAATCATTTGGCTGACTGGGCAGAAGAAAAATTGGATGGAAGATTAGGAAATGAAACCTTTGAT
    +GATTCTCAGTGGAGAGCAATTGCAATGGGTTTGAATAAAAAGAGGCCTGTATTGGTTATCCAAGGCCCT
    +CCTGGTACAGGCAAGACTGGTTTGCTCAAGCAACTTATAGCATGTGCTGTTCAGCAAGGTGAAAGGGTT
    +CTTGTTACAGCACCTACTAATGCAGCTGTTGATAACATGGTAGAAAAGCTTTCAAATGTTGGATTAAAT
    +ATAGTGCGGGTTGGAAATCCAGCTCGTATATCAAAAACAGTGGGATCAAAGTCTTTGGAAGAAATTGTA
    +AATGCTAAGCTTGCAAGTTTTCGAGAAGAGTATGAGAGGAAGAAGTCAGATCTAAGAAAAGATCTAAGA
    +CATTGTTTAAGGGATGATTCACTAGCTTCAGGCATACGCCAACTTCTGAAGCAACTGGGAAGGTCACTG
    +AAGAAAAAGGAAAAGCAGACCGTAATTGAAGTTCTGTCTAGTGCTCAAGTTGTGGTTGCCACTAATACT
    +GGAGCAGCTGACCCTTTGGTTCGAAGGCTAGATACCTTTGATTTGGTTGTCATAGATGAAGCGGGACAG
    +GCAATTGAACCCTCTTGCTGGATTCCTATATTGCAGGGAAAGCGCTGCATTCTTGCTGGTGATCAATGC
    +CAACTTGCTCCTGTCATATTATCTAGAAAGGCCTTAGAAGTTGGTCTAGGAATATCTCTACTGGAGAGA
    +GCTGCAACTTTGCATGAAGGGATTCTCACCACTAGGTTAACAACACAATACCGTATGAATGATGCAATT
    +GCTAGTTGGGCTTCAAAGGAGATGTACGGAGGATTATTGAAGTCCTCTGAGACTGTCTTTTCTCATCTT
    +CTAGTAGACTCTCCTTTTGTTAA
     Gm10   Glyma10g00210.1 CDS_3   21109   21392   -       4       8     
    +  30      42      52      GGACTTGGGGGAATGCATTTGGTGTTATTCAAGGTTGAAGGGA
    +ACCACCGGTTACCACCAACCACTCTTTCACCTGGAGACATGGTTTGTGTGAGAACATATGACAGCATGG
    +GTGCAATTACAACTTCTTGCATACAAGGATTTGTGAACAGTTTTGGGGATGATGGCTATAGTATTACAG
    +TTGCTTTAGAGTCACGCCATGGTGATCCTACATTCTCTAAACTATTTGGGAAGAGTGTGCGCATTGACC
    +GTATTCAAGGACTGGCTGATACACTTACTTATGA
     Gm10   Glyma10g00210.1 CDS_2   24354   24662   -       9       13    
    +  32      54      66      GCTCAGCATAGGGCGGTTGTGAGAAAGATAACGCAACCCAAGA
    +GTGTCCAAGGCGTTTTAGGAATGGACTTCGAAAAGGTCAAAGCATTACAGCACAGGATTGACGAATTCA
    +CCACCCATATGTCAGAACTACTCCGTATTGAAAGGGATGCTGAGTTGGAGTTTACTCAGGAGGAATTGG
    +ATGCTGTTCCTAAACCAGATGATACTTCTGATTCTTCAAAAACGATTGATTTCTTGGTTAGCCATAGCC
    +AGCCTCAACAAGAACTCTGCGACACCATTTGTAATTTAAACGCTATCAGTACCTCTACA
    
  3. or download this
    assembly        position        strand  class   mc      h
    10      8691    +       CG      12      12
    ...
    10      8718    -       CG      6       6
    10      8984    +       CG      7       7
    10      8991    +       CG      6       9
    
  4. or download this
    Chromosome      Gene    Feature Start   END     CG_count_by_C   CHG_co
    +unt_by_C  CHH_count_by_C
     Gm10   Glyma10g00200.1 CDS_11  8569    8705    0.143   0.071   0.000
     Gm10   Glyma10g00200.1 CDS_9   8885    9079    0.040   0.000   0.000
     Gm10   Glyma10g0test.1 CDS_11  8569    8705    0.143   0.071   0.000
    

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://962807]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others surveying the Monastery: (13)
As of 2014-04-18 18:34 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    April first is:







    Results (471 votes), past polls