Beefy Boxes and Bandwidth Generously Provided by pair Networks
Just another Perl shrine
 
PerlMonks  

Re: Text manipulation

by zentara (Archbishop)
on Nov 09, 2012 at 14:28 UTC ( #1003136=note: print w/ replies, xml ) Need Help??


in reply to Text manipulation

Use BioPerl


I'm not really a human, but I play one on earth.
Old Perl Programmer Haiku ................... flash japh


Comment on Re: Text manipulation
Replies are listed 'Oldest First'.
Re^2: Text manipulation
by frozenwithjoy (Curate) on Nov 09, 2012 at 16:41 UTC
    Ya, here is a BioPerl solution to interleave to sequences:
    #!/usr/bin/env perl use strict; use warnings; use Bio::SeqIO; my $fasta_in_1 = $ARGV[0]; my $fasta_in_2 = $ARGV[1]; my $fasta_out = ">interleave_1_2.fa"; my $seqio_in_1 = Bio::SeqIO->new( -file => $fasta_in_1, -format => 'Fasta', ); my $seqio_in_2 = Bio::SeqIO->new( -file => $fasta_in_2, -format => 'Fasta', ); my $seqio_out = Bio::SeqIO->new( -file => $fasta_out, -format => 'Fasta', ); while ( my $seq_obj_1 = $seqio_in_1->next_seq() ) { my $seq_obj_2 = $seqio_in_2->next_seq(); $seqio_out->write_seq($seq_obj_1); $seqio_out->write_seq($seq_obj_2); } __END__ >qppq ATATATTTATTATTATATATATTATATTATTA >dfj TATTATTATTTTATAT >lsl ATTATTATTATTATTAGGAGGAG >ghg ATATATAT

    However, I'm not entirely sure of the best way to delimit the pairs with ============ using this approach.

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1003136]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others rifling through the Monastery: (13)
As of 2015-07-07 16:17 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









    Results (91 votes), past polls