Beefy Boxes and Bandwidth Generously Provided by pair Networks
more useful options
 
PerlMonks  

Re^2: Text manipulation

by frozenwithjoy (Priest)
on Nov 09, 2012 at 16:41 UTC ( #1003180=note: print w/replies, xml ) Need Help??


in reply to Re: Text manipulation
in thread Text manipulation

Ya, here is a BioPerl solution to interleave to sequences:
#!/usr/bin/env perl use strict; use warnings; use Bio::SeqIO; my $fasta_in_1 = $ARGV[0]; my $fasta_in_2 = $ARGV[1]; my $fasta_out = ">interleave_1_2.fa"; my $seqio_in_1 = Bio::SeqIO->new( -file => $fasta_in_1, -format => 'Fasta', ); my $seqio_in_2 = Bio::SeqIO->new( -file => $fasta_in_2, -format => 'Fasta', ); my $seqio_out = Bio::SeqIO->new( -file => $fasta_out, -format => 'Fasta', ); while ( my $seq_obj_1 = $seqio_in_1->next_seq() ) { my $seq_obj_2 = $seqio_in_2->next_seq(); $seqio_out->write_seq($seq_obj_1); $seqio_out->write_seq($seq_obj_2); } __END__ >qppq ATATATTTATTATTATATATATTATATTATTA >dfj TATTATTATTTTATAT >lsl ATTATTATTATTATTAGGAGGAG >ghg ATATATAT

However, I'm not entirely sure of the best way to delimit the pairs with ============ using this approach.

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1003180]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others cooling their heels in the Monastery: (6)
As of 2016-10-01 19:56 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?
    How many different varieties (color, size, etc) of socks do you have in your sock drawer?






    Results (7 votes). Check out past polls.