Beefy Boxes and Bandwidth Generously Provided by pair Networks
Just another Perl shrine

Re^2: Text manipulation

by frozenwithjoy (Curate)
on Nov 09, 2012 at 16:41 UTC ( #1003180=note: print w/ replies, xml ) Need Help??

in reply to Re: Text manipulation
in thread Text manipulation

Ya, here is a BioPerl solution to interleave to sequences:

#!/usr/bin/env perl use strict; use warnings; use Bio::SeqIO; my $fasta_in_1 = $ARGV[0]; my $fasta_in_2 = $ARGV[1]; my $fasta_out = ">interleave_1_2.fa"; my $seqio_in_1 = Bio::SeqIO->new( -file => $fasta_in_1, -format => 'Fasta', ); my $seqio_in_2 = Bio::SeqIO->new( -file => $fasta_in_2, -format => 'Fasta', ); my $seqio_out = Bio::SeqIO->new( -file => $fasta_out, -format => 'Fasta', ); while ( my $seq_obj_1 = $seqio_in_1->next_seq() ) { my $seq_obj_2 = $seqio_in_2->next_seq(); $seqio_out->write_seq($seq_obj_1); $seqio_out->write_seq($seq_obj_2); } __END__ >qppq ATATATTTATTATTATATATATTATATTATTA >dfj TATTATTATTTTATAT >lsl ATTATTATTATTATTAGGAGGAG >ghg ATATATAT

However, I'm not entirely sure of the best way to delimit the pairs with ============ using this approach.

Comment on Re^2: Text manipulation
Select or Download Code

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1003180]
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others meditating upon the Monastery: (3)
As of 2015-04-19 09:44 GMT
Find Nodes?
    Voting Booth?

    Who makes your decisions?

    Results (358 votes), past polls