nested foreach loop, match DNA sequences and calculate score

Hi, I have issues designing a code that scans 2 DNA sequences (taken as input from user, of same length) and then compares the two sequences, nucleotide by nucleotide (e.g. compare nt 1 from sequence 1, with nt 1 from sequence 2 etc). I'm new to perl, I've tried several different ways but I don't seem to get anything working. With the code that I've tried, nothing is printed out at all, so the nested foreach loops seem to get stuck somewhere. I would be greatful for some help/advice. PS I know I should use script, I deleted all that to simplify my problem and will add all that later on once I figured out this problem. Code:

#!/usr/bin/perl
use warnings;


print("Please enter the first DNA sequence: ");
$DNAsequence1 = <STDIN>;
chomp($DNAsequence1);                                                 
+           
$DNAsequence1=uc($DNAsequence1);    
 $lengthDNA1=length $DNAsequence1;

print("\nPlease enter the second DNA sequenc (of same length as the fi
+rst): ");
$DNAsequence2 = <STDIN>;
chomp($DNAsequence2);                                                 
+           
$DNAsequence2=uc($DNAsequence2);
$lengthDNA2=length $DNAsequence2;
#print "The length of DNA sequence 2 is $lengthDNA2";

    if ($lengthDNA1==$lengthDNA2){    
print "DNA sequence 1: $DNAsequence1\nDNA sequence 2: $DNAsequence2\n"
+;
} else {
    print "\nThe DNA sequences are not of same lenght, please  try aga
+in!";
}

 @DNAsequence1=split(//,$DNAsequence1);
 @DNAsequence2=split(//,$DNAsequence2);


$score=0;                                 


foreach $base1 (@$DNAsequence1)
print $score;
{
    foreach $base2(@$DNAsequence2)
    {
        if($base1->[0] eq $base2->[0])
        {
    $score += 3;
    print $score;
} else 
{
    $score=$score+1; 
    }
}
}
print $score;
[download]

Comment on nested foreach loop, match DNA sequences and calculate score Download Code
Re: nested foreach loop, match DNA sequences and calculate score by roboticus (Canon) on Dec 18, 2012 at 15:38 UTC
NadjaPadjala: Your `$base1` and `$base2` variables aren't arrays, but you're treating them as such. Just try: `if ($base1 eq $base2)` [download] Also, your `print $score;` statement on line 32 should be inside the curly braces. There may be more issues, but that's all I see at the moment. ...roboticus When your only tool is a hammer, all problems look like your thumb.	[reply] [d/l] [select]
Re: nested foreach loop, match DNA sequences and calculate score by AnomalousMonk (Prior) on Dec 18, 2012 at 15:58 UTC
Do yourself a big favor and use warnings and strict in your code at the beginning of each and every script: `use warnings;` `use strict;` Using warnings and, in particular, strictures would have alerted you to the misuse of `@$DNAsequence1` and `$base1->[0]` et al.	[reply] [d/l] [select]
Re: nested foreach loop, match DNA sequences and calculate score by Cristoforo (Chaplain) on Dec 18, 2012 at 19:34 UTC
To show another way to calculate the matches. `#!/usr/bin/perl use strict; use warnings; my $fasta1 = 'GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGC +CAAC'; my $fasta2 = 'ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCA +GCAG'; my $matched = ($fasta1 ^ $fasta2) =~ tr/\0//; my $non_match = length($fasta1) - $matched; print "matched: $matched\n"; print "non_matched: $non_match\n";` [download] This prints: `matched: 15 non_matched: 45` [download]	[reply] [d/l] [select]
Re: nested foreach loop, match DNA sequences and calculate score by NadjaPadjala (Initiate) on Dec 19, 2012 at 16:06 UTC
Hi, Thank you all for your very fast and helpful advices! It helped me a lot, obviously I've been stuck with rather basic problems, not always seeming so logic when you're new to it. Thank you again! Nadja	[reply]


Just another Perl shrine
	PerlMonks

nested foreach loop, match DNA sequences and calculate score

The best material for plates (tableware) is: