Beefy Boxes and Bandwidth Generously Provided by pair Networks
Keep It Simple, Stupid

nested foreach loop, match DNA sequences and calculate score

by NadjaPadjala (Initiate)
on Dec 18, 2012 at 15:22 UTC ( #1009400=perlquestion: print w/replies, xml ) Need Help??
NadjaPadjala has asked for the wisdom of the Perl Monks concerning the following question:

Hi, I have issues designing a code that scans 2 DNA sequences (taken as input from user, of same length) and then compares the two sequences, nucleotide by nucleotide (e.g. compare nt 1 from sequence 1, with nt 1 from sequence 2 etc). I'm new to perl, I've tried several different ways but I don't seem to get anything working. With the code that I've tried, nothing is printed out at all, so the nested foreach loops seem to get stuck somewhere. I would be greatful for some help/advice. PS I know I should use script, I deleted all that to simplify my problem and will add all that later on once I figured out this problem. Code:
#!/usr/bin/perl use warnings; print("Please enter the first DNA sequence: "); $DNAsequence1 = <STDIN>; chomp($DNAsequence1); + $DNAsequence1=uc($DNAsequence1); $lengthDNA1=length $DNAsequence1; print("\nPlease enter the second DNA sequenc (of same length as the fi +rst): "); $DNAsequence2 = <STDIN>; chomp($DNAsequence2); + $DNAsequence2=uc($DNAsequence2); $lengthDNA2=length $DNAsequence2; #print "The length of DNA sequence 2 is $lengthDNA2"; if ($lengthDNA1==$lengthDNA2){ print "DNA sequence 1: $DNAsequence1\nDNA sequence 2: $DNAsequence2\n" +; } else { print "\nThe DNA sequences are not of same lenght, please try aga +in!"; } @DNAsequence1=split(//,$DNAsequence1); @DNAsequence2=split(//,$DNAsequence2); $score=0; foreach $base1 (@$DNAsequence1) print $score; { foreach $base2(@$DNAsequence2) { if($base1->[0] eq $base2->[0]) { $score += 3; print $score; } else { $score=$score+1; } } } print $score;

Replies are listed 'Best First'.
Re: nested foreach loop, match DNA sequences and calculate score
by roboticus (Chancellor) on Dec 18, 2012 at 15:38 UTC


    Your $base1 and $base2 variables aren't arrays, but you're treating them as such. Just try:

    if ($base1 eq $base2)

    Also, your print $score; statement on line 32 should be inside the curly braces. There may be more issues, but that's all I see at the moment.


    When your only tool is a hammer, all problems look like your thumb.

Re: nested foreach loop, match DNA sequences and calculate score
by AnomalousMonk (Canon) on Dec 18, 2012 at 15:58 UTC

    Do yourself a big favor and use warnings and strict in your code at the beginning of each and every script:
        use warnings;
        use strict;

    Using warnings and, in particular, strictures would have alerted you to the misuse of  @$DNAsequence1 and  $base1->[0] et al.

Re: nested foreach loop, match DNA sequences and calculate score
by Cristoforo (Deacon) on Dec 18, 2012 at 19:34 UTC
    To show another way to calculate the matches.
    #!/usr/bin/perl use strict; use warnings; my $fasta1 = 'GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGC +CAAC'; my $fasta2 = 'ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCA +GCAG'; my $matched = ($fasta1 ^ $fasta2) =~ tr/\0//; my $non_match = length($fasta1) - $matched; print "matched: $matched\n"; print "non_matched: $non_match\n";
    This prints:
    matched: 15 non_matched: 45
Re: nested foreach loop, match DNA sequences and calculate score
by NadjaPadjala (Initiate) on Dec 19, 2012 at 16:06 UTC
    Hi, Thank you all for your very fast and helpful advices! It helped me a lot, obviously I've been stuck with rather basic problems, not always seeming so logic when you're new to it. Thank you again! Nadja

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: perlquestion [id://1009400]
Approved by davido
and all is quiet...

How do I use this? | Other CB clients
Other Users?
Others chilling in the Monastery: (3)
As of 2016-12-05 03:40 GMT
Find Nodes?
    Voting Booth?
    On a regular basis, I'm most likely to spy upon:

    Results (72 votes). Check out past polls.