Extracting IDs from fasta file

[MBobur]

This node falls below the community's threshold of quality. You may see it by logging in.

[marto]

This isn't a code writing service. Consider actually reading and understanding the links given here.

[tmharish]

Can some one make me a script which can do that.

Short answer: No

Long answers: Here, Here and Here

[2teez]

Hi MBobur,
If I must add my voice to the wonderful wisdom, you have gotten before now.
Which would you rather prefer

• To follow both
  marto's wisdom in Re: intron length to one of your post,
  and that of
  blue_cowdawg which says:
  fellow monk, there are better ways to ask homework questions. First step in my opinion is to try and solve the problem yourself. If it works, you've accomplished something truly great. If it crashes, burns and dies in the flames then you'll accomplish even greater things by posting a well titled and formatted question to Seekers of Perl Wisdom so that others in a similar predicament as yours can learn by it. At least, in my honest opinion, is how Perl Monks is supposed to work.
• OR, I write this for you:

  use warnings;
  use strict;
  
  while (<DATA>) {
      print $1, $/ if m[^>(?=(.+?)\|)];
  }
  
  __DATA__
  >BTBSCRYR|IV|123123-43245273 tgcaccaaacatgtctaaagctggaaccaaaattactttct
  +ttgaagacaaaaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccg
  +ctg 
  >BTBSCRYADASR|IV|123123-43245273
  

  And you have to keep asking, what which stand for and how to do the next assignment/ or project?

I think, you will grow and become a better Perl user, even helping others if you choose to follow the wisdom(s) of those who has walked your path before now.
However, if all these doesn't make sense then you can check this: How do I post a question effectively?

[Sinistral]

Help With FASTA

In addition to the many useful responses you've received, one source of wisdom for Bioinformatics + Perl is the BioPerl Site, which you may not previously have been exposed to. I highly recommend you begin your search for a solution there. A quick search revealed a BioPerl page devoted just to FASTA, which will in turn lead you to the many Bio-Perl-Monks who have already developed solutions for just your problem.