Beefy Boxes and Bandwidth Generously Provided by pair Networks vroom
We don't bite newbies here... much
 
PerlMonks  

Re: Extracting IDs from fasta file

by 2teez (Chaplain)
on Mar 01, 2013 at 12:36 UTC ( #1021239=note: print w/ replies, xml ) Need Help??


in reply to Extracting IDs from fasta file

Hi MBobur,
If I must add my voice to the wonderful wisdom, you have gotten before now.
Which would you rather prefer

  • To follow both
    marto's wisdom in Re: intron length to one of your post,
    and that of
    blue_cowdawg which says:
    fellow monk, there are better ways to ask homework questions. First step in my opinion is to try and solve the problem yourself. If it works, you've accomplished something truly great. If it crashes, burns and dies in the flames then you'll accomplish even greater things by posting a well titled and formatted question to Seekers of Perl Wisdom so that others in a similar predicament as yours can learn by it. At least, in my honest opinion, is how Perl Monks is supposed to work.
  • OR, I write this for you:
    use warnings; use strict; while (<DATA>) { print $1, $/ if m[^>(?=(.+?)\|)]; } __DATA__ >BTBSCRYR|IV|123123-43245273 tgcaccaaacatgtctaaagctggaaccaaaattactttct +ttgaagacaaaaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccg +ctg >BTBSCRYADASR|IV|123123-43245273
    And you have to keep asking, what which stand for and how to do the next assignment/ or project?

I think, you will grow and become a better Perl user, even helping others if you choose to follow the wisdom(s) of those who has walked your path before now.
However, if all these doesn't make sense then you can check this: How do I post a question effectively?

If you tell me, I'll forget.
If you show me, I'll remember.
if you involve me, I'll understand.
--- Author unknown to me


Comment on Re: Extracting IDs from fasta file
Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1021239]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others drinking their drinks and smoking their pipes about the Monastery: (6)
As of 2013-05-21 05:32 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The best material for plates (tableware) is:









    Results (428 votes), past polls