Beefy Boxes and Bandwidth Generously Provided by pair Networks
No such thing as a small change
 
PerlMonks  

Re: put every sequence of a file in a different output file

by 2teez (Priest)
on Jun 13, 2013 at 16:54 UTC ( #1038800=note: print w/ replies, xml ) Need Help??


in reply to put every sequence of a file in a different output file

Hi bingalee,
I strongly guess you want to save each of the "sequence" starting from XLOC_.. till the space line.
If so,
the following can give you a head up: It saves each "sequence", into a different named file. (am using only the OP data here .... Please)

use warnings; use strict; my $fh; while (<DATA>) { chomp; if (/(XLOC_\d+$)/) { open $fh, '>', "$1.txt" or die $!; print $fh $_, $/; } else { print $fh $_, $/; } } __DATA__ XLOC_000039 >chr1:983051-985037 CATGACTTTGTCGGAATTATGTTACTGCTCATTATCAATTCCACCATTAGCTTCATAGAG GAAAACAATGCCGGGAATGCTGCTGCTGCGCTTATGGCCCGCCTCGCACCAAAATCCAAG GTAAGCCCCACACCCTACTTACCACTCCTTTTTCTTCTCAATACTGCTTTTCATCATGTT ACACTCATTTTCTAGGTTTTACGTGATGGAACCTGGAGTGAAATGGACGCATCTTTGTTG GTGCCCGGTGACATAATCAGCATTAAACTTGGAGACATCATTCCGGCAGATGCGCGTCTT CTCGAGGGAGATCCGCTGAAAATTGACCAGGTCTTTCTTGTGTCTCAATCATAGTGTTCT TGGTAGAGCGGAAAAAAAAATATTCTGATATGAAAATTACATGAGACACTAAAACACATA XLOC_000456 >chr1:12600284-12601781 CAACAATCTCTGATGATGCGGCAGGGCCTTGCTCGCGGGGCGTGGTGCTACCTCGAGGAT GAGTTCCTTGGCCAAAGGGAATCCCGGGCGCTTCTACTTGAGACAAAATTCCGCAACTTC CGCCAAGAGTCCTTGAGCATCACTGACTACTGCCGCCAGCTTGAGTCAATGGCGGCATCC CTTGCCGGTTTCGGCGATCCCATCGGCGATAGGCAGATGGTGCTCACGCTCCTTCGTGGC CTCGGCGGCAAGTTCCGTCACATGGTGTCCATCCTCAAGATGCACCAGCCGTTCCCCACG TTCGCAGAGGCTCGTGCGCACCTGCTGTTGGAGGAGCTGGAAATCGACGCACGACCTCCA TCACCGCCATCGGCACTTGTTGCTGCAGCGCCGCGGCATGCGACTCCGGGGGCCCCAGTA
The above is how far I can make of your question.
I'm sorry, if I get you wrong.
Please pay close attention to the comments before this.

If you tell me, I'll forget.
If you show me, I'll remember.
if you involve me, I'll understand.
--- Author unknown to me


Comment on Re: put every sequence of a file in a different output file
Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1038800]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others rifling through the Monastery: (11)
As of 2015-07-03 10:40 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









    Results (51 votes), past polls