Beefy Boxes and Bandwidth Generously Provided by pair Networks
good chemistry is complicated,
and a little bit messy -LW

Re: Simple regex question. Grouping with a negative lookahead assertion.

by BrowserUk (Pope)
on Jul 14, 2013 at 01:39 UTC ( #1044189=note: print w/ replies, xml ) Need Help??

in reply to Simple regex question. Grouping with a negative lookahead assertion.

Like this?

[0] Perl> $dna = 'atctcggataatgggataaaaatataggctataaatggcgccccggctaatt +ttt';; [0] Perl> print $1 while $dna =~ m[atg(.+?)(?=taa|tag|tga)]g;; gga gcgccccggc

If so, the difference is the use of the non-greedy match quantifier +?

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

Comment on Re: Simple regex question. Grouping with a negative lookahead assertion.
Select or Download Code
Re^2: Simple regex question. Grouping with a negative lookahead assertion.
by Anonymous Monk on Jul 14, 2013 at 01:50 UTC
    That's very close. I was also trying to prevent any characters that were not in the following character class, [acgt], from being included in the match.

    Thanks for the quick response.
      I just modified and tested the code.

      The minor modification will work. I should have seen the necessary addition of the non-greedy mode quantifier.

      Thanks again.
      I was also trying to prevent any characters that were not in the following character class, [acgt], from being included in the match.

      Is that a possibility? If so, then substitute that for . in my regex. (S'not rocket science.)

      But, if it is a possibility, then you could (should) have included a non-acgt character in your example.

      And if the example you provided is realistic, then using [acgt] is redundant, because your example consists entirely of those characters.

      With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
      Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
      "Science is about questioning the status quo. Questioning authority".
      In the absence of evidence, opinion is indistinguishable from prejudice.

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1044189]
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others taking refuge in the Monastery: (10)
As of 2014-10-24 12:55 GMT
Find Nodes?
    Voting Booth?

    For retirement, I am banking on:

    Results (131 votes), past polls