Beefy Boxes and Bandwidth Generously Provided by pair Networks
Do you know where your variables are?

Re: Simple regex question. Grouping with a negative lookahead assertion.

by BrowserUk (Pope)
on Jul 14, 2013 at 01:39 UTC ( #1044189=note: print w/ replies, xml ) Need Help??

in reply to Simple regex question. Grouping with a negative lookahead assertion.

Like this?

[0] Perl> $dna = 'atctcggataatgggataaaaatataggctataaatggcgccccggctaatt +ttt';; [0] Perl> print $1 while $dna =~ m[atg(.+?)(?=taa|tag|tga)]g;; gga gcgccccggc

If so, the difference is the use of the non-greedy match quantifier +?

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

Comment on Re: Simple regex question. Grouping with a negative lookahead assertion.
Select or Download Code
Replies are listed 'Best First'.
Re^2: Simple regex question. Grouping with a negative lookahead assertion.
by Anonymous Monk on Jul 14, 2013 at 01:50 UTC
    That's very close. I was also trying to prevent any characters that were not in the following character class, [acgt], from being included in the match.

    Thanks for the quick response.
      I was also trying to prevent any characters that were not in the following character class, [acgt], from being included in the match.

      Is that a possibility? If so, then substitute that for . in my regex. (S'not rocket science.)

      But, if it is a possibility, then you could (should) have included a non-acgt character in your example.

      And if the example you provided is realistic, then using [acgt] is redundant, because your example consists entirely of those characters.

      With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
      Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
      "Science is about questioning the status quo. Questioning authority".
      In the absence of evidence, opinion is indistinguishable from prejudice.
      I just modified and tested the code.

      The minor modification will work. I should have seen the necessary addition of the non-greedy mode quantifier.

      Thanks again.

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1044189]
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others drinking their drinks and smoking their pipes about the Monastery: (11)
As of 2015-08-03 12:18 GMT
Find Nodes?
    Voting Booth?

    The oldest computer book still on my shelves (or on my digital media) is ...

    Results (35 votes), past polls