Re^3: translating multiple DNA sequence to protein sequence

Replies are listed 'Best First'.
Re^4: translating multiple DNA sequence to protein sequence by choroba (Cardinal) on Aug 22, 2013 at 09:25 UTC
I tested the code with the following data: `>header1 ATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTG CATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTGC >header2 ATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTGC ATGATCTAGTCGATCGCTAGCTAGATCGCTAGCTGC` [download] It gives the follwoing output: Read more... (1211 Bytes) Please, be more specific and explain what you mean by "won't work". لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ	[reply] [d/l] [select]
Re^5: translating multiple DNA sequence to protein sequence by yuvraj_ghaly (Sexton) on Aug 22, 2013 at 10:22 UTC
from the output I concluded that it is only for the ">header1". Moreover, this is not the required output the output which i require is something like that: `>header1 HGADFFADJHGAJFGAFLGJ >header2 HJFSAGJFADGADKJAHGHJ` [download] The UPPERCASE is the translated sequence of the DNA sequences	[reply] [d/l]
Re^6: translating multiple DNA sequence to protein sequence by choroba (Cardinal) on Aug 22, 2013 at 10:28 UTC
I see both header1 and header2 in the output. Moving one part of the print out of the loop is rather easy, you should study how loops work. لսႽ† ᥲᥒ⚪⟊Ⴙᘓᖇ Ꮅᘓᖇ⎱ Ⴙᥲ𝇋ƙᘓᖇ	[reply]
Re^7: translating multiple DNA sequence to protein sequence by yuvraj_ghaly (Sexton) on Aug 22, 2013 at 10:39 UTC
Re^8: translating multiple DNA sequence to protein sequence by yuvraj_ghaly (Sexton) on Aug 27, 2013 at 05:23 UTC


Don't ask to ask, just ask
	PerlMonks