Beefy Boxes and Bandwidth Generously Provided by pair Networks
Your skill will accomplish
what the force of many cannot
 
PerlMonks  

Re: Reading file into a hash

by hippo (Curate)
on May 28, 2014 at 14:51 UTC ( #1087661=note: print w/ replies, xml ) Need Help??


in reply to Reading file into a hash

I think that the problem is that you are setting the value of $seq to be '' but then testing it via defined, which (other than the first time through) it will be. Change your test from if ( defined $seq ) to just if ($seq) and see what difference that makes.


Comment on Re: Reading file into a hash
Select or Download Code
Re^2: Reading file into a hash
by PerlSufi (Friar) on May 28, 2014 at 14:53 UTC
    Hi hippo,
    Thanks for the response. I changed it and still did not get the last header and sequence
      Thats a very common problem, you are trying to add a record only when the successor is to be parsed, but the last record has no successor (sic ;)!

      Most people try to solve by repeating code to add the last record after the loop.

      But it's much cleaner this way (avoiding a posteriori state logic)

      use strict; use warnings; use Data::Dump; my $header; my %sequence; while ( my $line = <DATA> ){ chomp $line; if ( $line =~ /^>(.*)/ ) { $header = $1; } else { $sequence{$header} .= $line; } } dd \%sequence; __DATA__ >sequence_5849 CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC TCCCACTAATAATTCTGAGG >sequence_5959 CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT ATATCCATTTGTCAGCAGACACGC >sequence_0808 CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC TGGGAACCTGCGGGCAGTAGGTGGAAT
      output
      { sequence_0808 => "CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGAC +CAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT", sequence_5849 => "CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTC +CGGCCTTCCCTCCCACTAATAATTCTGAGG", sequence_5959 => "CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCG +CCGAAGGTCTATATCCATTTGTCAGCAGACACGC", }

      Cheers Rolf

      ( addicted to the Perl Programming Language)

      update

      a *general pattern* to solve such problems while staying DRY is to use references

      if ( $line =~ /^(HEAD_PATTERN)/ ) { $data = \ $deeply{nested}{structure}{$1}; # reference data + } else { $$data .= $line; # derefrence data }

      like this you don't need to repeat the path of a deeply nested data structure, which might vary in multiple dimensions

      update
      added some explanation

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1087661]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others studying the Monastery: (9)
As of 2014-10-20 22:28 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    For retirement, I am banking on:










    Results (92 votes), past polls