Command or Perl script for changing headers of multiple FASTA files in a specific order listed in a txt file

[Anonymous Monk]

Assalam o alaikum everyone,

I am working with multiple genes and in each gene folder i have multiple FASTA (70-75) files and each FASTA file contains single gene sequence. e.g.

AMY2b_Gene_folder

Chimpanzee_AMY2B_CDS.fasta
Human_AMY2B_CDS.fasta
Pygmy_chimpanzee_AMY2B_CDS.fasta
Western_gorrila_AMY2B_CDS.fasta

cat Chimpanzee_AMY2B_CDS.fasta

 >lcl|NM_020978.4_cds_NP_066188.1_1 [gene=AMY2B] [protein=alpha-amylas
+e 2B precursor] [protein_id=NP_066188.1] [location=673..2208]
ATGAAGTTCTTTCTGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCCCAAATACACAACAAG
+GACGGACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATATT
+TAGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCAATTCACAACCCTT
+TC

cat Human_AMY2B_CDS.fasta

 >lcl|NM_020978.4_cds_NP_066188.1_1 [gene=AMY2B] [protein=alpha-amylas
+e 2B precursor] [protein_id=NP_066188.1] [location=673..2208]
ATGAAGTTCTTTCTGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCCCAAATACACAACAAG
+GACGGACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATATT
+TAGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCAATTCACAACCCTT
+TC

I want to change headers of each fasta file according to a specific order given in text file.

cat Headers.txt
MP.C_AMY2B
FP.H_AMY2B

Desired output should be look like

 >MP.C_AMY2B
 ATGAAGTTCTTTCTGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCCCAAATACACAACAA
+G GACGGACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATA
+TTT AGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCAATTCACAACC
+CTTTC

Kindly guide me is there any command-line solution to do so(which work for multiple FASTA files which have single gene sequence)????

2017-09-16 Athanasius added code tags

[1nickt]

Hi, What have you tried, and how did it not work for you?

Also, please edit your post to use <code></code> tags, as shown in the instruction directly below the Preview button. (Gonna be hard to be a programmer if you don't read the instructions.)

Update: Hm, I missed that you posted anonymously and cannot therefore edit your post. (Thanks hippo.) Better to create a user account, in order to be able to update a post, and for other reasons...)

[Anonymous Monk]

well i have tried the following code:

i put the following function in linux enviroment: and(i guess problem is here but unbable to fix it )

function sedinho () { sed -i  "s/^.*\]/>$1/g" $2;}
export -f sedinho

create variables of : list of new headers (LIST1) list of input files (LIST2)

LIST1=($(cat Headers.txt))
LIST2=($(find /folder/with/fasta/files/ -maxdepth 0 -name "*CDS.fasta"
+ | sort))

parallel --xapply sedinho {1} {2} ::: ${LIST1[@]} ::: ${LIST2[@]}

ERROR:

zsh:1: command not found: sedinho

zsh:1: command not found: sedinho

zsh:1: command not found: sedinho

how to put a function in linux environment accurately ??

[poj]

This Perl script does the first part reading the filenames and headers into an array using File::Find. How is the order of the lines in Header.txt matched to these filenames/headers ?

#!/usr/bin/perl
use strict;
use File::Find;
use Data::Dumper;

my $folder = '/folder/with/fasta/files';

my @files=();
find( \&process, $folder );
print Dumper \@files;

sub process { 
  return unless $_ =~ /CDS\.fasta$/;
  my $file = $File::Find::name;
  open my $fh,'<',$file or die $!;
  my $header = <$fh>;
  close $fh;
  push @files,[$File::Find::dir,$_,$header];
}

poj