Beefy Boxes and Bandwidth Generously Provided by pair Networks
Perl: the Markov chain saw
 
PerlMonks  

Re^2: How do you match a stretch of at least N characters

by Anonymous Monk
on Sep 12, 2017 at 19:27 UTC ( #1199225=note: print w/replies, xml ) Need Help??


in reply to Re: How do you match a stretch of at least N characters
in thread How do you match a stretch of at least N characters

Original post deleted. What I posted was completely wrong.

You're supposed to <strike></strike> out the wrong answer not delete

  • Comment on Re^2: How do you match a stretch of at least N characters

Replies are listed 'Best First'.
Re^3: How do you match a stretch of at least N characters
by paisani (Initiate) on Sep 13, 2017 at 20:43 UTC

    Is this what you were looking for? The longest matching DNA string? You can save the max length found below to get your result.

    Answer:

    Found match of length (102) at position(506, 0):

    AAATTGGTGTATATGAAAGACCTCGACGCTATTTAGAAAGAGAGAGCAATATTTCAAGAATGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAAT
    AAATTGGTGTATATGAAAGACCTCGACGCTATTTAGAAAGAGAGAGCAATATTTCAAGAATGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAAA

    my $i=-1; while(++$i < length($reference_str)) { my $j=-1; while(++$j < length($small_str)) { my $length = 9; my $match=undef; while ( $i+$length < length($reference_str) and $j+$length < length($small_str) and compareSnippet($i, $j, ++$length) ) { $match++; } if ( $match) { $length--; print "Found match of length ($length) at position($i, $j): +\n"; print substr($reference_str, $i, $length) . "\n"; print substr($small_str, $j, $length). "\n"; $i+= $length; $j+= $length; next; } } } sub compareSnippet { my ( $pos_i, $pos_j, $length) = @_; my $ref = substr($reference_str, $pos_i, $length); my @ref_arr = sp +lit('', $ref); my $small = substr($small_str, $pos_j, $length); my @small_arr = sp +lit('', $small); return undef if length($ref) < $length or length($small) < $length; return equal(\@ref_arr, \@small_arr); } sub equal { my ($first, $second) = @_; my $mismatch=0; foreach my $i (0..(@$first-1)) { $mismatch++ if $first->[$i] ne $second->[$i]; return undef if $mismatch > 1; } # print "Woo! (@$first, @$second)\n" if $mismatch == 0; return 1; }

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1199225]
help
Chatterbox?
and all is quiet...

How do I use this? | Other CB clients
Other Users?
Others imbibing at the Monastery: (7)
As of 2017-11-23 00:29 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?
    In order to be able to say "I know Perl", you must have:













    Results (327 votes). Check out past polls.

    Notices?