Beefy Boxes and Bandwidth Generously Provided by pair Networks
good chemistry is complicated,
and a little bit messy -LW
 
PerlMonks  

Re^2: non-exact regexp matches

by Anonymous Monk
on Jun 25, 2004 at 15:14 UTC ( #369635=note: print w/replies, xml ) Need Help??


in reply to Re: non-exact regexp matches
in thread non-exact regexp matches

Hi, I tested your program on the following sequence:
ACCAACCGGATTCTAGATGCAGATGTTGAAGATT # works OK. Change the second C for a G: AGCAACCGGATTCTAGATGCAGATGTTGAAGATT # Doesn't work.
I'm looking over your regexp... bu it'll take me a while to figure it out. Thanks for the help. Vince

Replies are listed 'Best First'.
Re^3: non-exact regexp matches
by japhy (Canon) on Jun 25, 2004 at 15:22 UTC
    That's because Abigail-II's regex only handles the case of deletions. To support insertions and modifications, you need a more robust approach.
    _____________________________________________________
    Jeff[japhy]Pinyan: Perl, regex, and perl hacker, who'd like a job (NYC-area)
    s++=END;++y(;-P)}y js++=;shajsj<++y(p-q)}?print:??;
      Thanks Jeff. I think I read up some more on advanced regexp before i get in over my head. Vince

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://369635]
help
Chatterbox?
[Tux]: and the defailt is 15?
[choroba]: sorry, typo. Works for me with 15 which is the default
[choroba]: Timestamps should work correctly now
[Tux]: I need 17 on both my boxes

How do I use this? | Other CB clients
Other Users?
Others romping around the Monastery: (8)
As of 2017-09-19 20:16 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?
    During the recent solar eclipse, I:









    Results (228 votes). Check out past polls.

    Notices?