Beefy Boxes and Bandwidth Generously Provided by pair Networks
Do you know where your variables are?

Re: simple perl script to trim a FASTA file

by almut (Canon)
on Apr 08, 2010 at 22:10 UTC ( #833648=note: print w/ replies, xml ) Need Help??

in reply to simple perl script to trim a FASTA file

trim off x nucleotides from the beginning, and y nucleotides from the end
#!/usr/bin/perl while (<DATA>) { s/^(?!>)...(.*)..../$1/; # ^^^ ^^^^ # x=3 y=4 print; } __DATA__ >HWI-EAS158_40_3_1_46_535 GTGAATGCGTGATACAGGAATGTTCGTTGTGACCAT >HWI-EAS158_40_3_1_47_579 AAAGTGAATGCGTGATACAGGAATGTTCGTTGTGAC >HWI-EAS158_40_3_1_46_731 GTGTCATGCGTGATACAGGAATGTTCGTTGTGAAAA

For longer stretches you can also write .{N} (with N being the number of nucleotides to trim).

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://833648]
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others musing on the Monastery: (5)
As of 2016-06-25 15:40 GMT
Find Nodes?
    Voting Booth?
    My preferred method of making French fries (chips) is in a ...

    Results (326 votes). Check out past polls.