Beefy Boxes and Bandwidth Generously Provided by pair Networks Cowboy Neal with Hat
Problems? Is your data what you think it is?
 
PerlMonks  

perl script to sort out the genes which i have in the human chromosome

by anisha3 (Initiate)
on May 15, 2012 at 14:43 UTC ( #970649=perlquestion: print w/ replies, xml ) Need Help??
anisha3 has asked for the wisdom of the Perl Monks concerning the following question:

ths script has matching the gene id with human chromosome and also with snp file then gives output but the problem s its takng lots of time n unabl 2 get d desired op please help me out!!!!!!

#!/usr/bin/perl $inputFile = $ARGV[0]; chomp($inputFile); open(IN,"$inputFile"); unless(open(IN, $inputFile)){ print "Error: Cannot open file \"$inputFile\".\n\n"; exit; } @genes=<IN>; delete($Dna[0]); close IN; $i=1; foreach $geneLine(@genes){ #$geneLine = "ENSG00000204873 TAAATAGTGGTCATAACAAATATATTATCTAAT +AAG"; @gl = split('\t', $geneLine); #print "\n".$gl[0]." - ".$gl[1]; #for($i=1; $i<2; $i++){ $chrFile = "human_chromosomes/chr".$i.".fa"; chomp($chrFile); open(CHR,"$chrFile"); unless(open(CHR, $chrFile)){ print "Error: Cannot open file \"$snpFile\".\n\n"; exit; } @chr = <CHR>; delete($chr[0]); close CHR; $chrSeq = join('', @chr); $chrSeq =~s/\s//g; # Remove white space $chrSeq =~ s/($chrSeq)/\U$1/gi; @chrFrags = split/$gl[1]/,$chrSeq; $count = @chrFrags; if($count>1){ $n = length($chrFrags[0]); $startPos = $n; $length = length($gl[1]); $snpFile = "SNP_CHROMOSOMES/chr".$i.".subst.fa"; chomp($snpFile); open(SNP,"$snpFile"); unless(open(SNP, $snpFile)){ print "Error: Cannot open file \"$snpFile\".\n\n"; exit; } @snp = <SNP>; delete($snp[0]); close SNP; $snpSeq = join('', @snp); $snpSeq =~s/\s//g; # Remove white space $snpSeq =~ s/($snpSeq)/\U$1/gi; $seqMatch = substr($snpSeq,$startPos,$length); print "Gene ID: $gl[0]\nStart position = $startPos \nLengt +h = $length\n"; print "Choromosome $i.\n"; print "\nGene : ".$gl[1]."\nSNP : $seqMatch\n"; ($snpMatch1=$seqMatch)=~s/[ATGC]/-/g; ($snpMatch2=$snpMatch1)=~s/[\w]/+/g; #$snpMatch2=~s/[-]/0/g; print "Match: $snpMatch2\n\n############################## +##################################################################### +####\n\n"; } else{ #print "match not found\n"; } #} }

Comment on perl script to sort out the genes which i have in the human chromosome
Download Code
Re: perl script to sort out the genes which i have in the human chromosome
by marto (Chancellor) on May 15, 2012 at 14:53 UTC

    You should start by adding the following lines at the start of your code:

    use strict; use warnings;

    Start working through your code defining variables and you'll find a few problems (e.g, delete($Dna[0]); is the first mention of $Dna).

Re: perl script to sort out the genes which i have in the human chromosome
by sauoq (Abbot) on May 15, 2012 at 18:16 UTC
    its takng lots of time n unabl 2 get d desired op please help me out!!!!!!

    Is there an SMS/perlmonks gateway I don't know about?

    -sauoq
    "My two cents aren't worth a dime.";

      oh! you need to get used to it... no big deal really.

      Get with the times man.. textation is big these days(also, it's way cooler, why write the full word whn u can cut wrds short like dis) even here..

      Also, Things like "give me solution ASAP!!!!" , "please haaaaalp !!!!" are common.

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: perlquestion [id://970649]
Approved by marto
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others romping around the Monastery: (8)
As of 2014-04-19 01:06 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    April first is:







    Results (475 votes), past polls