Beefy Boxes and Bandwidth Generously Provided by pair Networks
P is for Practical
 
PerlMonks  

Re: replace FASTA sequence headers

by Cristoforo (Deacon)
on Jun 10, 2012 at 20:41 UTC ( #975480=note: print w/ replies, xml ) Need Help??


in reply to replace FASTA sequence headers

If you are going to be working with fasta and genes, you might want to see BioPerl. A lot of code has been developed to handle Biogenetics problems. Here is how you might want to parse and print the fasta file using Bio::SeqIO (and Bio::Seq for methods like display_id).

#!/usr/bin/perl use strict; use warnings; use Bio::SeqIO; my %lookup; open my $fh, "<", 'input2.txt' or die $!; while (<$fh>) { chomp; my ($id, $replace) = split /\t/; $lookup{$id} = $replace; } close $fh or die $!; my $in = Bio::SeqIO->new( -file => "input1.txt" , -format => 'fasta'); my $out = Bio::SeqIO->new( -file => '>test.dat', -format => 'fasta'); while ( my $seq = $in->next_seq() ) { if (defined(my $replace = $lookup{ $seq->id })) { $seq->display_id($replace); } $out->write_seq($seq); } __END__ *** input 1 >chr1 AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGC CAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAAT TTTATCTTTAGGCGGTATGCACTTTTAACAAAAAANNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAAC CAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCNNNN >chrM GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT TTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTG GAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATT CTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACCTACTA AAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAAT GTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAANAATTTCCACC >GJKKTUG01DYDGC GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGCCAAC ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCAGCAG ACATGAGGAATACAAACTACAATCTTTTACTTGATGATGCAATGCCGGACAAACTCTAGA >F0Z7V0F01EDB3V AAGGCGAGNGGTATCACGCAGTAAGTTACGGTTTTCGGGTAACGCGTCNGNGGNACTAAC CCACGGNGGGTAACCCGTCNCTACCGGTATAGGACTAAGGTTACCGGAACGTCGTGGGGT ACCCCCCGGACGGGGACCGTCCCCTCATANAGTCAACNGTNTGAGATGGACTAACTCAAA CCTAGTTTCAAGTACTATTTAACTTACTTACGTTACCCGTAATTTCGGCGTTTAGAGGCG *** input 2 chr1 headA chrM headB
This prints out (to file 'test.dat'):

>headA AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAA AAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTAGGCGGTATGC ACTTTTAACAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCA TACCCCGAACCAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCNNNN >headB GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC GCAGTATCTGTCTTTGATTCCTGCCTCATTCTATTATTTATCGCACCTACGTTCAATATT ACAGGCGAACATACCTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA ACAATTGAATGTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAANAATTTCCACC >GJKKTUG01DYDGC GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGCCAAC ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCAGCAG ACATGAGGAATACAAACTACAATCTTTTACTTGATGATGCAATGCCGGACAAACTCTAGA >F0Z7V0F01EDB3V AAGGCGAGNGGTATCACGCAGTAAGTTACGGTTTTCGGGTAACGCGTCNGNGGNACTAAC CCACGGNGGGTAACCCGTCNCTACCGGTATAGGACTAAGGTTACCGGAACGTCGTGGGGT ACCCCCCGGACGGGGACCGTCCCCTCATANAGTCAACNGTNTGAGATGGACTAACTCAAA CCTAGTTTCAAGTACTATTTAACTTACTTACGTTACCCGTAATTTCGGCGTTTAGAGGCG

Chris


Comment on Re: replace FASTA sequence headers
Select or Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://975480]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others chanting in the Monastery: (5)
As of 2014-09-20 03:34 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    How do you remember the number of days in each month?











    Results (152 votes), past polls