Beefy Boxes and Bandwidth Generously Provided by pair Networks
go ahead... be a heretic
 
PerlMonks  

Re: Need help with code

by grondilu (Pilgrim)
on Oct 19, 2012 at 05:03 UTC ( #999870=note: print w/ replies, xml ) Need Help??


in reply to Need help with code

You should use the 'g' regex modifier imho (see perlretut).

#!/usr/bin/perl -w use strict; use warnings; use feature qw(say); use constant GENETIC_CODE => { TCA => 'S', # Serine TCC => 'S', # Serine TCG => 'S', # Serine TCT => 'S', # Serine TTC => 'F', # Phenylalanine TTT => 'F', # Phenylalanine TTA => 'L', # Leucine TTG => 'L', # Leucine TAC => 'Y', # Tyrosine TAT => 'Y', # Tyrosine TAA => '_', # exit TAG => '_', # exit TGC => 'C', # Cysteine TGT => 'C', # Cysteine TGA => '_', # exit TGG => 'W', # Tryptophan CTA => 'L', # Leucine CTC => 'L', # Leucine CTG => 'L', # Leucine CTT => 'L', # Leucine GTT => 'V', # Valine GTC => 'V', # Valine GTA => 'V', # Valine GTG => 'V', # Valine GCT => 'A', # Alanine GCC => 'A', # Alanine GCA => 'A', # Alanine GCG => 'A', # Alanine GAT => 'D', # Aspartic Acid GAC => 'D', # Aspartic Acid GAA => 'E', # Glutamate GAG => 'E', # Glutamate GGT => 'G', # Glycine GGC => 'G', # Glycine GGA => 'G', # Glycine GGG => 'G', # Glycine CCA => 'P', # Phenylalanine CCC => 'P', # Phenylalanine CCG => 'P', # Phenylalanine CCT => 'P', # Phenylalanine CAC => 'H', # Histidine CAT => 'H', # Histidine CAA => 'Q', # Glutamine CAG => 'Q', # Glutamine CGA => 'R', # Arginine CGC => 'R', # Arginine CGG => 'R', # Arginine CGT => 'R', # Arginine ATA => 'I', # Isoleucine ATC => 'I', # Isoleucine ATT => 'I', # Isoleucine ATG => 'M', # Methionine ACA => 'T', # Threonine ACC => 'T', # Threonine ACG => 'T', # Threonine ACT => 'T', # Threonine AAC => 'N', # Asparagine AAT => 'N', # Asparagine AAA => 'K', # Lysine AAG => 'K', # Lysine AGC => 'S', # Serine AGT => 'S', # Serine AGA => 'R', # Arginine AGG => 'R', # Arginine }; my $s = 'AGCCATGTAGCTAACTCAGGTTACATGGGGATGACCCCGCGACTTGGATTAGAGTCTCTTT +TGGAATAAGCCTGAATGATCCGAGTAGCATCTCAG'; for ($s =~ /ATG (?:[ACGT]{3})*? (?: TAA | TAG | TGA )/gx) { my @codons = /[ACGT]{3}/g; say join '', map GENETIC_CODE->{$_}, @codons; }

This gives me the following output:

M_
MGMTPRLGLESLLE_

PS. Thanks anyway for telling us about this site, it's pretty cool. It's kind like a game, except that you're doing some actual scientific work.

I solved the problem with some perl6 code:

use v6; constant DNA-codon = Hash.new: < TTT F CTT L ATT I GTT V TTC F CTC L ATC I GTC V TTA L CTA L ATA I GTA V TTG L CTG L ATG M GTG V TCT S CCT P ACT T GCT A TCC S CCC P ACC T GCC A TCA S CCA P ACA T GCA A TCG S CCG P ACG T GCG A TAT Y CAT H AAT N GAT D TAC Y CAC H AAC N GAC D TAA Stop CAA Q AAA K GAA E TAG Stop CAG Q AAG K GAG E TGT C CGT R AGT S GGT G TGC C CGC R AGC S GGC G TGA Stop CGA R AGA R GGA G TGG W CGG R AGG R GGG G >; sub revc($dna) { $dna.comb.reverse.join.trans: [<A C T G>] => [<T G A C>] } sub orf($dna) { my %match; my @match = gather for $dna, revc $dna { take .match: rx/ ATG [ <[ACGT]>**3 ]*? <before TAA|TAG|TGA> /, :ov +erlap; }; %match{ [~] map { DNA-codon{$_} }, .match: rx/ <[ACGT]>**3 /, :g }++ for @match; return %match.keys; } .say for orf open('rosalind_orf.txt').get;

The "overlap" option was much useful.


Comment on Re: Need help with code
Select or Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://999870]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others taking refuge in the Monastery: (16)
As of 2014-08-22 17:14 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The best computer themed movie is:











    Results (161 votes), past polls