Beefy Boxes and Bandwidth Generously Provided by pair Networks
Your skill will accomplish
what the force of many cannot
 
PerlMonks  

Comment on

( #3333=superdoc: print w/ replies, xml ) Need Help??

The lines of the First file are long so they are being printed in multiple lines. Previously I only gave one line now I am including many lines in the following file sample for file 1 I hope file2 format is understandable.

Gm10 Glyma10g00200.1 CDS_11 8569 8705 - 2 2 6 + 10 14 GAAGAACCAAAATCGCTGATTTTGAAAAATAGGGGGACTGAATGTCTTGATTT +GGAAATAGGGGGACCAAAATTGCGGATTGAGCATTATAGGGGACCAATAGTGTATTTTAGCCTTTATTT +TATTTTGAATGTGTG Gm10 Glyma10g00200.1 CDS_10 8822 8822 - 0 0 0 + 0 0 G Gm10 Glyma10g00200.1 CDS_9 8885 9079 - 2 13 2 +3 38 50 GTATTTGTGTATTGCTCCTGGATCTAGACCTTCCCCTGTTGCTGCTGCTGCT +GCAAGTCACAAATTAATCACATGTATTTCATGCTTCGATGAGCGTTCACTTGCATATCATGCTGTTGGA +TATGGAAGAGGATCTCACATTCCAGCAGTAGCCATTACATCATCAGGCACTGCAGTTTCCAACCTTCTT +CCTGC Gm10 Glyma10g00200.1 CDS_8 9151 9255 - 2 2 11 + 15 19 GTTGGATCATGCCAATGAATTATCAAACTCCCTGAAAGAAAGTGCCAATATTA +ACACTGTTCGGGCATCGCTTATTGTTGAAGAATGCACAAGACTTGGTTTGAT Gm10 Glyma10g00200.1 CDS_7 11534 11698 - 1 7 +16 24 33 GGAATATACTGATCCTCACAAAGGTTCTCTTAACCTTGCTGTGAAGTTGCC +TAATGGTTCTCTAAAGCCAGACCTGGGGCCAAAAACATATATTGCTTATGGATTTCTTCAGGAGCTTGG +ACGTGGTGATTCAGTGACTAAGCTCCATTGTGATATGTCTGATGC Gm10 Glyma10g00200.1 CDS_6 12777 12823 - 0 0 +8 8 11 GCTTTTTACACAAATTTCATTCTTCACCTTCATTCTCATGAAGATTA Gm10 Glyma10g00200.1 CDS_5 12958 13022 - 1 4 +4 9 10 GCTGTAGATCTTCAGTACAAGTATTTAAGGCATTTTCAGTGGCATTGGGAAAA +GGGGGAACCGCT Gm10 Glyma10g00200.1 CDS_4 13348 13502 - 0 4 +20 24 33 GAGGATCCTTATCTTCTTCTTGGGTTCTGAAAAAATAAAAACATCAACTCC +CTCCTGTATTCATGCTTGGTGTTGGTTATGTGTCATGTCTGGTCTACTATTGACACATGTAAATCCAAA +TGCACTAGAGCTGCCCTCAAAAAACTCAATTTGGT Gm10 Glyma10g00200.1 CDS_3 13713 13829 - 0 2 +13 15 25 GATTGAGTTAGATGAGCTGGAAAGTGTTTCCATTCTGTCAATGACCCTTGC +ATGGGATGAATTTTCCTTCTCTACTTTTCAAGAAGCCCATTATTCACTTCAAGATTCTCTAGACCA Gm10 Glyma10g00200.1 CDS_2 13915 14209 - 8 11 + 40 59 88 GCTGCTCTTCTCCCTCAGCTGCTCTGTCTCCGGCGTTGACATTGGAGGAG +GGACTTGAGAAACTGAAGGAGGCTCTCCAAATCTTGAATTCTCCTTCCCCTTCTTCCCCTACTGGATTC +CTTAGGTTTCAGGTGGCGCTCCCTCCCAGTCCTAAGACCTTCACTTTGTTTTGCTCCCAACCCCACTCC +TCCTCGGTCTTTCCTCTCATTTATGTTTCCAAGAACGACGCCGACTCTAAATCACTCTATGTCAATTTG +GATGATAATGTGAGTCACCGGAAAGAAAGGTTCTTTTT Gm10 Glyma10g00200.1 CDS_1 14242 14286 - 2 1 +9 12 21 GATCTCGTTCCCCCTCACCACATAACACCCTGTCGTTCCCTTCAC Gm10 Glyma10g00210.1 CDS_7 15480 15722 - 4 7 +26 37 47 GGTACGATCAAACACATTGGGAGCTGTTGGATTCCTTGGGGATAGCAGAAG +AATCAATGTTGCCATCACAAGAGCACGCAAACATTTAGCTTTGGTCTGTGACAGCTCGACTATATGCCA +CAATACCTTCTTAGCAAGGCTTCTGCGTCATATTAGACACTTTGGTAGGGTGAAGCATGCAGAACCAGG +TAGTTTTGGAGGATATGGACTTGGGATGAATCCAATATTACCTTCCATTAATTA Gm10 Glyma10g00210.1 CDS_6 16625 16782 - 1 9 +15 25 32 GGTGTTAGCCCAACAGCTATTGCAGTGCAATCCCCTTATGTTGCTCAAGTA +CAACTTTTGAGGGACAAGCTTGATGAATTTCCAGAAGCAGCAGGTACTGAGGTTGCAACCATTGACAGT +TTTCAAGGTCGGGAAGCTGATGCAGTAATTTTATCCAT Gm10 Glyma10g00210.1 CDS_5 17595 17763 - 2 9 +16 27 34 GCCTACTTGGATAACACAATGCCCGCTGCTATTGCTAGATACTAGAATGCC +ATATGGAAGTCTGTCAGTTGGTTGTGAAGAGCATCTAGACCCGGCTGGAACAGGCTCACTTTATAATGA +AGGAGAAGCTGAGATAGTTTTGCAGCATGTATTTTCCTTAATCTATGCC Gm10 Glyma10g00210.1 CDS_4 18046 19077 - 12 42 + 91 145 173 GCGCAACTGTGAAGCTTTAATGCTGCTTCAGAAGAATGGTTTACGAA +AGAAGAATCCTTCAATTTCTGTTGTTGCTACACTGTTTGGAGATGGGGAAGATGTTGCATGGCTTGAGA +AAAATCATTTGGCTGACTGGGCAGAAGAAAAATTGGATGGAAGATTAGGAAATGAAACCTTTGATGATT +CTCAGTGGAGAGCAATTGCAATGGGTTTGAATAAAAAGAGGCCTGTATTGGTTATCCAAGGCCCTCCTG +GTACAGGCAAGACTGGTTTGCTCAAGCAACTTATAGCATGTGCTGTTCAGCAAGGTGAAAGGGTTCTTG +TTACAGCACCTACTAATGCAGCTGTTGATAACATGGTAGAAAAGCTTTCAAATGTTGGATTAAATATAG +TGCGGGTTGGAAATCCAGCTCGTATATCAAAAACAGTGGGATCAAAGTCTTTGGAAGAAATTGTAAATG +CTAAGCTTGCAAGTTTTCGAGAAGAGTATGAGAGGAAGAAGTCAGATCTAAGAAAAGATCTAAGACATT +GTTTAAGGGATGATTCACTAGCTTCAGGCATACGCCAACTTCTGAAGCAACTGGGAAGGTCACTGAAGA +AAAAGGAAAAGCAGACCGTAATTGAAGTTCTGTCTAGTGCTCAAGTTGTGGTTGCCACTAATACTGGAG +CAGCTGACCCTTTGGTTCGAAGGCTAGATACCTTTGATTTGGTTGTCATAGATGAAGCGGGACAGGCAA +TTGAACCCTCTTGCTGGATTCCTATATTGCAGGGAAAGCGCTGCATTCTTGCTGGTGATCAATGCCAAC +TTGCTCCTGTCATATTATCTAGAAAGGCCTTAGAAGTTGGTCTAGGAATATCTCTACTGGAGAGAGCTG +CAACTTTGCATGAAGGGATTCTCACCACTAGGTTAACAACACAATACCGTATGAATGATGCAATTGCTA +GTTGGGCTTCAAAGGAGATGTACGGAGGATTATTGAAGTCCTCTGAGACTGTCTTTTCTCATCTTCTAG +TAGACTCTCCTTTTGTTAA Gm10 Glyma10g00210.1 CDS_3 21109 21392 - 4 8 +30 42 52 GGACTTGGGGGAATGCATTTGGTGTTATTCAAGGTTGAAGGGAACCACCGG +TTACCACCAACCACTCTTTCACCTGGAGACATGGTTTGTGTGAGAACATATGACAGCATGGGTGCAATT +ACAACTTCTTGCATACAAGGATTTGTGAACAGTTTTGGGGATGATGGCTATAGTATTACAGTTGCTTTA +GAGTCACGCCATGGTGATCCTACATTCTCTAAACTATTTGGGAAGAGTGTGCGCATTGACCGTATTCAA +GGACTGGCTGATACACTTACTTATGA Gm10 Glyma10g00210.1 CDS_2 24354 24662 - 9 13 + 32 54 66 GCTCAGCATAGGGCGGTTGTGAGAAAGATAACGCAACCCAAGAGTGTCCA +AGGCGTTTTAGGAATGGACTTCGAAAAGGTCAAAGCATTACAGCACAGGATTGACGAATTCACCACCCA +TATGTCAGAACTACTCCGTATTGAAAGGGATGCTGAGTTGGAGTTTACTCAGGAGGAATTGGATGCTGT +TCCTAAACCAGATGATACTTCTGATTCTTCAAAAACGATTGATTTCTTGGTTAGCCATAGCCAGCCTCA +ACAAGAACTCTGCGACACCATTTGTAATTTAAACGCTATCAGTACCTCTACA

There are a total of 11 tab separated values in each line 1.) Chromosome (in this case Gm10) 2.) gene id(or Gene) 3.) Feature( which could be of many types CDS_\d or 5'UTR_\d or 3'UTR_\d e.t.c 4.) Start position of the gene 5.) End position 6.) Strand type + or - 7 to 11 ) different counts of different types 12) the Sequence.

Thanks graff for doing all the work. I'll try to see how your code works. But my other issue is I have 80 such files to compare with Methylation.gtf. I hope it can be done more efficiently. Thanks btw for all help appreciate it


In reply to Re^2: Comparing and getting information from two large files and appending it in a new file by perlkhan77
in thread Comparing and getting information from two large files and appending it in a new file by perlkhan77

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.
  • Log In?
    Username:
    Password:

    What's my password?
    Create A New User
    Chatterbox?
    and the web crawler heard nothing...

    How do I use this? | Other CB clients
    Other Users?
    Others taking refuge in the Monastery: (15)
    As of 2015-07-28 13:43 GMT
    Sections?
    Information?
    Find Nodes?
    Leftovers?
      Voting Booth?

      The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









      Results (255 votes), past polls