Beefy Boxes and Bandwidth Generously Provided by pair Networks
Syntactic Confectionery Delight
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??
AAAAAAA AAAAAAT AAAAAAG AAAAAAC

Are all your patterns the same length? Are they all upper case? Are you looking for exact (including case) matches only?

Is it possible to obtain a copy of the patterns file?

A small extract from a fasta file I have kicking around (HG:chr20):

... NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GATCCAgaggtggaagaggaaggaagcttggaaccctatagagttgctga gtgccaggaccagatcctggccctaaacaggtggtaaggaaggagagagt gaaggaactgccaggtgacacactcccaccatggacctctgggatcctag ctttaagagatcccatcacccacatgaacgtttgaattgacagggggagc ...

index is usually faster for matching constant strings, but if you you want case independent matches, you would need to uc the sequences before searching (and studying).


With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

The start of some sanity?


In reply to Re^3: counting the number of 16384 pattern matches in a large DNA sequence by BrowserUk
in thread counting the number of 16384 pattern matches in a large DNA sequence by anonym

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others meditating upon the Monastery: (5)
As of 2024-04-24 08:10 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found