Getting all the parameters of CGI request

[drblove27]

Dear Monks,

I am sure there is a simple command for this, but my google-fu is failing me. I would like to write a perl script that does a LWP request on a cgi page. To do so, I need the parameters, and sloshing through the HTML to figure out the parameters is hurting my head. Is there a simple command where I can feed a url to it, and it will spit out all the possible parameters that can be passed for the request?

Specifically I am looking to script this site:
http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi

Getting the check boxes and input sequence.

Thanks in advance!

Here is the initial code, that posts the results on the page, but does not submit them:

Updated with failed code

Rather I should say that the result of this file, is the original webpage with the variables as given by the code, but the code does not press the "Pick Primers" button....

#!/usr/bin/perl

use LWP::UserAgent; 
$ua = LWP::UserAgent->new; 
$ua->agent("Mozilla 8.0");

use HTTP::Request::Common qw(POST);

my $req = (POST 'http://www.bioinformatics.nl/cgi-bin/primer3plus/prim
+er3plus.cgi', 
["SEQUENCE" => "AATGAGTTAATAGAATCTTTACAAATAAGAATATACACTTCTGCTTAGGATGAT
+AATTGGAGGCAAGTGAATCCTGAGCGTGATTTGATAATGACCTAATAATGATGGGTTTTATTTCCAGAC
+TTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCACAGTGGAAGAAT
+TTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAAAATATCATC[C]GGTGTTTC
+CTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGCCAACTAGAAGAGGTAAGAAACTATGTGAA
+AACTTTTTGATTATGCATATGAACCCTTCACACTACCCAAATTATATATTTGGCTCCATATTCAATCGG
+TTAGTCTACATATATTTATGTTTCCTCTATGGGTAAGCTACTGTGAATGGATCAATTAATAAAACACAT
+GACCTATGCTTTAAGAAGCTTGCAAACACATGAAA",
 "SCRIPT_DETECTION_PICK_LEFT" => "checked",
 "SCRIPT_DETECTION_PICK_RIGHT" => "checked"
 ]);

$request = $ua->request($req); 
$content = $request->content; 

open(OUTPUT,">output_here.html");
print OUTPUT "$content";
close(OUTPUT);
exit;

[trwww]

Perhaps WWW::Mechanize::Shell is what you are looking for? For example after fetching the page the forms command lists all forms and fields:

$ perl -MWWW::Mechanize::Shell -eshell

(no url)>get http://www.bioinformatics.nl/.../primer3plus.cgi
Retrieving http://www.bioinformatics.nl/.../primer3plus.cgi(200)

http://www.bioinformatics.nl/.../primer3plus.cgi> forms
Form [1]
POST http://www.bioinformatics.nl/.../primer3plus.cgi
(multipart/form-data) [mainForm]

... snip list of fields and default values where relevant ...

[jettero]

It may not list out the params, but it sure will help filling out the form: WWW::Mechanize. Most of the values will have defaults, so you'll only have to set one or two of them and you're done.

[ikegami]

It may not list out the params,

Sure it does. $mech->forms gets you the forms, and $form->inputs gets you a form's inputs.

[holli]

Get Firefox and the Firebug extension.