Beefy Boxes and Bandwidth Generously Provided by pair Networks DiBona
Syntactic Confectionery Delight
 
PerlMonks  

jpearl's scratchpad

by jpearl (Scribe)
on Apr 13, 2009 at 21:36 UTC ( #757285=scratchpad: print w/ replies, xml ) Need Help??

UPDATE Slightly better formatting

This is a GUI designed to display gene sequences for different bacteria. The file format is thus:

<cluster start> CGSSp11BS70_00075

<genes start>

>CGSSp11BS70_00075

ATGCATCTTTATTTTATGAAATTTTTTACTATTTTTTCCATTTTACCACAGAAAAAGTTG

AAAAACAAAGAAGAATCATACTTTTTTGTAATTTATAATAACATGTTTTCAAACACATTA

ATTGACACGAAGTTAATATTATTATACAATTATCTTATGGAAGTCTCAGATTTATATAGT

ATCAGATTAAAACATATTCTAGCAAGGGAGATAGCA

>RefSpSangerINV104B_02430

ATGCATCTTTATTTTATGAAATTTTTTACTATTTTTTCCATTTTACCACAGAAAAAGTTG

AAAAACAAAGAAGAATCATACTTTTTTGTAATTTATAATAACATGTTTTCAAACACATTA

ATTGACACGAAGTTAATATTATTATACAATTATCTTATGGAAGTCTCAGATTTATATAGT

ATCAGATTAAAACATATTCTAGCAAGGGAGATAGCA

<genes stop>

<adjuncts start>

<adjuncts stop>

<strains start>

CGSSp11BS70 1

CGSSp14BS292 0

CGSSp14BS69 0

CGSSp18BS74 0

CGSSp19BS75 0

CGSSp23BS72 0

CGSSp3BS71 0

CGSSp6BS73 0

CGSSp9BS68 0

CGSSp9vBS293 0

CGSSpBS397 0

CGSSpBS455 0

CGSSpBS457 0

CGSSpBS458 0

RefSpD39 0

RefSpPAT6420135 0

RefSpR6 0

RefSpSanger23F 0

RefSpSangerINV104B 1

RefSpSangerINV200 0

RefSpSangerOXC141 0

RefSpTIGR4 0

RefSpTIGR6706B 0

gnl 1

<strains stop>

<cluster stop>

This is one record. The idea is a "cluster" is named by a representative gene name which belongs to a group of related genes. The lines which begin with:

>strain_gene.name

Are the sequence associated with that particular gene. My program should read through the file, when it is in the portion of the record which examines the representative sequence $isGene is set to true, and adds all lines which are DNA (of that sequence). When $isStrains is true that means its counting the number of total strains that belong to the cluster etc.

The hash (%cHash) which I return should be of the type:

clutster_name=> array[0] == genesequence

array1 == list

of all

strains

in cluster

Hrm. Ok, that's kinda it. Please let me know any parts which are not clear!

#!/usr/local/bin/perl use Tk; use Cwd; use warnings; use strict; use Data::Dumper; # Main Window my $mw = new MainWindow; my $lab = $mw -> Label( -text => " Gene Cluster View + Utility ", -font => "ansi 12 bold") -> grid( -row =>1, -column =>1, -columnspan =>3, -sticky =>"nsew"); #Declare that there is a menu my $mbar = $mw -> Menu(); $mw -> configure(-menu => $mbar); #The Main Buttons my $file = $mbar -> cascade( -label => "File", -underline => 0, -tearoff => 0); my $others = $mbar -> cascade( -label => "Others", -underline => 0, -tearoff => 0); my $help = $mbar -> cascade( -label => "Help", -underline => 0, -tearoff => 0); ## File Menu ## $file -> command( -label => "New", -underline => 0); #-command => sub { $txt -> delete('1.0','end'); +} ); $file -> command( -label => "Load clusterReport", -underline => 0, -command => [\&open_file, "Open"]); $file -> command( -label => "Save", -underline => 0, -command => [\&save_file, "Save"]); $file -> separator(); $file -> command( -label => "Exit", -underline => 1, -command => sub { exit } ); ##List Boxes for the Genes## my $strain_label = $mw -> Label( -text => " Strain List + ", -font => "ansi 12 bold" +) -> grid( -row =>2, -column =>1 ); my $core_label = $mw -> Label( -text => " Core Gene +s List ", -font => "ansi 12 bold" +) -> grid( -row =>2, -column =>2 ); my $distributed_label = $mw ->Label( -text => " Distributed +Genes List ", -font => "ansi 12 bold" +) -> grid( -row =>2, -column =>3 ); my $strain_lst = $mw ->Scrolled( 'Listbox', -scrollbars =>"oe, os") -> grid( -row =>3, -column =>1 ); my $core_lst = $mw ->Scrolled( 'Listbox', -scrollbars =>"oe, os") -> grid( -row =>3, -column =>2 ); my $distributed_lst = $mw ->Scrolled( 'Listbox', -scrollbars =>"oe, os") -> grid( -row =>3, -column =>3 ); my $gene_txt = $mw ->Scrolled( 'Text', -scrollbars =>"oe, os") -> grid( -row =>4, -column =>1, -columnspan =>3 ); MainLoop; ################# ###SUBROUTINES### ################# sub open_file { my $types; my $open_file_loc = $mw->getOpenFile(-filetypes => $types); print qq{You chose to open "$open_file_loc"\n} if $open_file_loc +; my ($nRef, $hRef) = &parse_file($open_file_loc); &disp_contents($nRef, $hRef); } sub save_file { my $types; my $save = $mw->getSaveFile(-filetypes => $types, -initialfile => 'test'); print qq{You chose to save as "$save"\n} if $save; } #Parse the clusterGene file takes the file location as input sub parse_file{ my $cluster; my $strain; my $isStrainLst = 0; my $iscluster = 0; my $isGene = 0; my %cHash; my $file_loc=shift; my $count=0; my $numStrains=0; chdir "/"; open (F, "$file_loc") or die "Cannot open file because:\n $!"; while (<F>){ chomp; #Reset bools if we reach end of record if ( $isGene && /^>/){ $isGene = 0; } if(/<strains stop>/){ $isStrainLst = 0; $numStrains=$count;#annoying, this will happen a lot. try +to think of a better way } #Check if we are in a gene, if so we need to add its sequence if ($isGene){ if (exists $cHash{$cluster}){ $cHash{$cluster}[0]=$cHash{$cluster}[0].$_; } else{ $cHash{$cluster}[0]=$_; #print "Cluster is ".$cluster." and gene is $_\n"; } } if ($isStrainLst){ /\s+([a-zA-Z0-9]+)\s+([0-1])/; push @{$cHash{$cluster}[1]}, $1 unless($2==0);#make HoAoA $count++ unless ($numStrains>0);#count to determine core/d +ist } if(/(<cluster start> )([a-zA-Z0-9]+)(_[a-zA-Z0-9]+)($)/){ $cluster = $2.$3; $strain = $2; } #This is the start of the representative sequence if (/^>$cluster/){ $isGene = 1; } #Find strain list(to diff core and dist genes) if (/<strains start>/){ $isStrainLst=1; } } return ($numStrains, \%cHash); } sub disp_contents{ my ($numStrains, $hashref) = @_; print $numStrains; if (ref($hashref) ne "HASH"){die "Expecting a hash ref got". ref($ +hashref);} print Dumper($hashref); }
Log In?
Username:
Password:

What's my password?
Create A New User
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others perusing the Monastery: (6)
As of 2013-05-23 07:46 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The best material for plates (tableware) is:









    Results (476 votes), past polls