1) I'm new to this and this is the best place I could find to put this, if I'm wrong, please let me know.

2) I'm on Windoze. Linux may be free, but I play lots of Win32/NT based games.

I currently run WinXP and had a little trouble finding how to put Perl on it. I have ActiveState Perl now, but under "Perl Installation" in the Getting Started With Perl part of the Tutorials, there isn't one for Windows.

I suggest the following be added:

Installing Perl on a Windows PC

Simply go to ActiveState's ActivePerl Download Site and either fill in the blanks or not and click "Next". Download the MSI package for Windows if you want the Uninstall option or the AS package if you don't care about that option. Simply run the MSI (an executable) and follow the installation guidelines.

You can now write Perl programs in any text editor and run them through the Command Prompt.

Am I completely out of line with this, or is this okay? I know MS products are generally frowned upon, but some people who like to just dabble a bit do have their OS.

Well, cheers,

BP
GRW

Comment on Tutorials Suggestion
Re: Tutorials Suggestion
by davido (Bishop) on Jul 28, 2004 at 17:51 UTC
    Your suggestion is a good one. However, while we always like to entertain suggestions for things that require Cabal or godly intervention, for normal things like posting nodes the Monastery is more about pitching in than about suggesting. What you've written would probably be just fine as a tutorial. ...so go ahead, write it up and submit it to the Tutorials section.

    Dave

      I did that. I wrote up The Scalar Range Operator with the intent/hope that it migrate into Tutorials. But it didn't. I had a brief discussion about this with castaway, who said that there is not a process for taking tutorial submissions and getting them on to the Tutorials page.

        There isn't an automated process. One of the Janitors has to plug it into the page for you, I believe. I thought that SiteDocClan could plug it in too, but as a member of SiteDoc, I'm now seeing that it's not within my powers. At any rate, if the Janitors like it, it should get plugged in before too long.

        Dave

Re: Tutorials Suggestion
by Mr. Muskrat (Abbot) on Jul 29, 2004 at 01:13 UTC
Re: Tutorials Suggestion
by Chady (Priest) on Jul 29, 2004 at 10:38 UTC
    I'm on Windoze. Linux may be free, but I play lots of Win32/NT based games.

    I find it odd that people who state that they use Windows™ need to explain themselves in a similar way as "forgive me, for I have sinned."

    Perl is not only for Linux, and you are not required to use Linux in order to contribute to this community. It's your right to choose whatever you like to use.

    just my 2 cents


    He who asks will be a fool for five minutes, but he who doesn't ask will remain a fool for life.

    Chady | http://chady.net/
      It's because a lot of people bash MS OSes. A lot of people don't realize (or are in denial) that the typical user who wants to just learn to program only has one machine they use for a lot of different tasks. It's because of this prejudiced bashing (which I will admit I do from time to time, but not a message board) that MS OS users feel the need to sort of bow down to the ^nix users. I understand that the MS OSes were not specifically designed for programming and that there are better systems. At the same time, I don't want the verbal abuse that I have run across in this community over what system I run.

      I completely agree that Perl is for everyone. For that matter, every language should work on every OS, but that's just me, I guess.

      My 2c. on that. Sorry it's getting OT, but I feel it needed to be said.

        People should feel free to learn Perl on whichever environment is convenient.

        Just so long as they remember to bow dow to Unix users, everything is fine :-)

        --
        TTTATCGGTCGTTATATAGATGTTTGCA

        I'm happy for MS OSes to be bashed. They need it. I'm also more than happy to bow down to Unix users. The ones I've met here have been very helpful.

        I draw the line at bashing windows users. Often they come to perl with no background in unix, c or even no programing experience at all. The learning curve is obviously steeper ('the command prompt?').

        I've just installed my first module from CPAN (I couldn't find it with ppm). If it wasn't for the marvellous tachyon (again, many thanks) patiently holding my hand as I painfully stumbled my way through I would never have done it. node_id=378614 (I've just looked at it again and I want to weep!)

        I welcome giricredwolf's tutorial, it will help me and many others.

        ...and I nearly forgot my excuse, I'm addicted to pinball!

Re: Tutorials Suggestion
by dmorgo (Pilgrim) on Jul 30, 2004 at 23:49 UTC
    >Simply go to ActiveState's ActivePerl Download Site...

    Yes, a tutorial is a good idea. A couple of suggestions for your writeup:

    When making a link, especially in a tutorial, it's good to have the URL appear explicitly in the text, for people who are going off a written printout of the tutorial.

    Also, it might be good to link to http://www.activeperl.com/ (the main page) rather than a subpage, the URL of which is more likely to change.

    Finally, when telling people how to install Perl on Windows, I find an important point to mention is they should have administrator access on their machine. Otherwise the install becomes more complicated (have to manually go and associate the .pl file extension with perl.exe).

    But it's a great idea to have such a tutorial.

      I greatly appreciate these reccomendations and will be updating the item I submitted to the Tutorial section right after posting this!

      Since I have XP Pro and my main account is an Admin. account, and I moved to this from 98SE, I forget that its NT base has the Admin. restrictions.

      Also, your link information is a good point... I think I'll add better navigation to it.

      Thanks!