Re^2: Converting Uniprot File to a Fasta File in Perl

[pearllearner315]

for the last group which will belong to the "SQ" line, how would i capture the multi line sequence into a variable? I would think to use  $line =~ /^SQ\s+(.*)/ again but that regex would capture the multiple white spaces in between the sequence.

[poj]

Use a flag to capture the multiple lines. Remove the spaces with a regex.

my %hash=();
my $seq;
my $flag = 0;
while (<$ufh>) {
  chomp;
    
  if ( /^(AC|OS|OX|ID|GN|SQ)\s+(.*)/ ){
    print  "<$1> <$2>\n";
    $hash{$1} = $2;
    $flag = 1 if /SQ/;
  } elsif (/^K\s+/){
    $flag = 0;
  } elsif ($flag == 1){
    s/ +//g; # remove spaces
    $seq .= $_."\n"
  } 
} 
print Dumper \%hash;
print $seq;

poj

[pearllearner315]

hi poj! thank you so much for your help! could you explain what the flag is actually doing? i'm reading the code and i'm having difficulty understanding. also what is Dumper? i'm trying to format my code so that I can get this type of output once i parse the headers and sequence:

 >NM_012514 | Rattus norvegicus | breast cancer 1 (Brca1) | mRNA
 CGCTGGTGCAACTCGAAGACCTATCTCCTTCCCGGGGGGGCTTCTCCGGCATTTAGGCCT
 CGGCGTTTGGAAGTACGGAGGTTTTTCTCGGAAGAAAGTTCACTGGAAGTGGAAGAAATG
 GATTTATCTGCTGTTCGAATTCAAGAAGTACAAAATGTCCTTCATGCTATGCAGAAAATC
 TTGGAGTGTCCAATCTGTTTGGAACTGATCAAAGAACCGGTTTCCACACAGTGCGACCAC
 ATATTTTGCAAATTTTGTATGCTGAAACTCCTTAACCAGAAGAAAGGACCTTCCCAGTGT
 CCTTTGTGTAAGAATGAGATAACCAAAAGGAGCCTACAAGGAAGTGCAAGG

[huck]

Once you find the SQ line you set the flag, then you accumulate all further lines(without the spaces) into $seq untill you find a line the begins with K and only has spaces or nothing after it. Then you unset the flag.

Dumper is a nice way to printout arrays and hashes for inspection, also works with scalars too

as for your output, it will look something like

print $hash{AC}; 
print ' | ' 
print $hash{OS}; 
print ' | ' 
print $hash{OX}; 
print ' | ' 
print $hash{ID}; 
print ' | ' 
print $hash{GN}; 
print "\n"; 
my $split_after=50; 
while (length($seq)>$split_after){ 
  print substr($seq,0,50)."\n"; 
  $seq=substr($seq,$split_after);
  } 
print $seq."\n";

Since your sample input doesnt seem to have your sample output values i cant say what the sequence of the print statements should look like. And you may need to adjust $split_after, i didnt feel like counting

[AnomalousMonk]

Data::Dumper.