BLAST and BioPerl

[GeneticistDrew]

Hello all, I started to use Perl a couple a days ago and would like to ask my first question... I have been using BioPerl and all seems to be OK, however I cannot use StandAloneBlast. I've followed "http://www.bioperl.org/wiki/HOWTO:Beginners" down to BLAST, which I have installed as instructed on "http://www.ncbi.nlm.nih.gov/books/NBK52637/" but this is where the problems begin. To put it simply, I don’t know how to use/install NCBI Blast for use with BioPerl. I put a sequence database "Anopheles-gambiae-PEST_TRANSCRIPTS_AgamP3.7.fa" into the “db” folder of “blast-2.2.28+”. I then attempted to use the BLAST tool to find a specific DNA sequence within my database, as instructed on the bioperl beginners page.

#!/bin/perl -w
use warnings;
use Bio::Seq;
use Bio::Tools::Run::StandAloneBlast;
 
$blast_obj = Bio::Tools::Run::StandAloneBlast->new(-program  => 'blast
+n', -database => 'Anopheles-gambiae-PEST_TRANSCRIPTS_AgamP3.7.fa');
 
$seq_obj = Bio::Seq->new(-id  =>"AGAP007280_query", -seq =>"TCTCGAGATG
+GCGAACCTGCTGCAGGGGTTCAGCGAGATGGGTCCAGCCAAAGAGAAGACGACGCCACAGTATGAGG")
+;
 
$report_obj = $blast_obj->blastall($seq_obj);
 
$result_obj = $report_obj->next_result;
 
print $result_obj->num_hits;

The output is as follows:

Replacement list is longer than search list at C:/Dwimperl/perl/site/l
+ib/Bio/Ran
ge.pm line 251.
Use of uninitialized value $_[0] in string eq at C:/Dwimperl/perl/lib/
+File/Spec/
Win32.pm line 152.

--------------------- WARNING ---------------------
MSG: cannot find path to blastall
---------------------------------------------------
Can't call method "next_result" on an undefined value at bioperl_blast
+2.pl line
12.

I don't know how to define the path to blastall, which for the moment is probably the biggest issue. I’m not sure if I have been very clear, but I’m very new to this… thanks in advance!