Re^3: Regular expressions

[AnomalousMonk]

I would have organized the code slightly differently, factoring each of the pattern elements into a separate  qr// regex object and combining them together (inside a capture group) in the final  m// match:

c:\@Work\Perl\monks>perl -wMstrict -le
"my $codon = qr{ [ACGT]{3}       }xms;
 my $start = qr{ ATG             }xms;
 my $end   = qr{ TAG | TAA | TGA }xms;
 ;;
 my $seq = 'AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAACGAA';
 ;;
 print qq{'$1'} while $seq =~ m{ ($start $codon*? $end) }xmsg;
"
'ATGGTTTCTCCCATCTCTCCATCGGCATAA'
'ATGATCTAA'

Separate  qr// definitions ease maintenance and, if variable names be wisely chosen, are self-commenting. If possible, I only use capture groups in the final  m// match due to the confusion that trying to count nested capture groups can produce.