Beefy Boxes and Bandwidth Generously Provided by pair Networks DiBona
There's more than one way to do things
 
PerlMonks  

Problems with 'use lib'

by hotshot (Prior)
on Aug 21, 2003 at 06:26 UTC ( #285370=perlquestion: print w/ replies, xml ) Need Help??
hotshot has asked for the wisdom of the Perl Monks concerning the following question:

Hello all!

My project is placed in two different locations depends whether I'm on the development environment or on the production environment, therefore I have an enviraonment variable that holds the location according to the environment. The problem is that I need to do:
use lib $projectLocation; # the environment variable I was talking +about
and this doesn't seem to work, I shouts a lot of error regarding uninitialized values in lib.pm. It seems that this work only when writing the path explicitly, like that:
use lib '/some/location/';
Is there something I can do?

Hotshot

Comment on Problems with 'use lib'
Select or Download Code
Re: Problems with 'use lib'
by lestrrat (Deacon) on Aug 21, 2003 at 06:41 UTC

    Remember that "use" statement is executed at compile time. Most likely your $projectLocation is not initialized. You could do something like this instead:

    BEGIN { my $projectLocation = '...'; # somehow initialize this unshift @INC, $projectLocation; } use MyProjectPackage;
Re: Problems with 'use lib'
by shenme (Priest) on Aug 21, 2003 at 06:53 UTC
    When and where does $projectLocation get defined?

    The "use lib" action is done at compile time, before statements like

    my $projectLocation = '/some/other/place';
    can be executed to set the variable.   You need to force your value to be defined during compilation.   Perhaps this might be more like what you were thinking?
    BEGIN { my $projectLocation = '/some/other/place'; use lib $projectLocation; }
    But then this gets back to something like the starting question - where does the value for $projectLocation come from?   Ah, an environment variable.   So maybe
    BEGIN { use lib $ENV{MYLIBRARYDIR}; printf "in BEGIN: '%s'\n", join("', '", @INC ); }
    will do what you want.

      I don't think this code will do what you want:

      BEGIN { my $projectLocation = '/some/other/place'; use lib $projectLocation; }
      The "use lib" inside the BEGIN block will be executed before the assignment since it is also inside the BEGIN block. Try this instead:
      my $projectLocation; BEGIN { $projectLocation = '/some/other/place'; } use lib $projectLocation;
      The "use" is like another BEGIN so these two pieces of code will be executed in sequence now.

      -- Eric Hammond

        I was going to say that wasn't true, but went back and looked at the last test program I was using and decided I hadn't tested that situation correctly.   Using code
        BEGIN { my $foo = 'foom'; use lib $foo; }
        results in error messages
        Use of uninitialized value in string eq at /usr/lib/perl5/5.8.0/i386-linux-thread-multi/lib.pm line 29.
        Empty compile time value given to use lib at hotshot.pl line 5
        
        Using your code
        my $foo; BEGIN { $foo = 'foom'; } use lib $foo; printf "executing: '%s'\n", join("', '", @INC );
        returns the desired results
        executing:  'foom', '/usr/lib/perl5/5.8.0/i386-linux-thread-multi', ... , '.'
        
        Just to try something different I tried
        BEGIN { our $foo = 'foom'; } use lib $foo;
        which also worked.

        Another thing to put in the list of things to re-study.   Key is that "use" (and other pragmas?) are executed (at compile time) before surrounding code at the same apparent 'level'.   By enclosing code in a BEGIN block ahead of the "use" we force it into compile time execution before the following "use" is executed.   (Or something like that ;-)

Re: Problems with 'use lib'
by tcf22 (Priest) on Aug 21, 2003 at 06:53 UTC
    You say that it is an environment variable. Do you assign the variable to $projectLocation before you use lib. Try printing out $projectLocation before it is used, to see what its value is. Perhaps this will work:
    use lib $ENV{projectLocation}; #or whatever the env variable is
Re: Problems with 'use lib'
by hotshot (Prior) on Aug 21, 2003 at 07:19 UTC
    The thing is I'm initializing $projectLocation to the invironment variable if it exists, otherwise I initialize (in my development environment), on the production environment it doesn't exist so initialize it to another location (predifined one).

    Hotshot
Re: Problems with 'use lib'
by esh (Pilgrim) on Aug 21, 2003 at 07:41 UTC

    The thing is I'm initializing $projectLocation to the invironment variable if it exists, otherwise I initialize (in my development environment), on the production environment it doesn't exist so initialize it to another location (predifined one).
    Putting it all together I offer:
    my $projectLocation; BEGIN { $projectLocation = $ENV{DEVLOCATION} || '/default/production/location'; } use lib $projectLocation;

    -- Eric Hammond

      You can do that all in one line, no BEGIN block needed:
      use lib $ENV {DEVLOCATION} || '/default/production/location';

      Abigail

Re: Problems with 'use lib'
by The Mad Hatter (Priest) on Aug 21, 2003 at 12:04 UTC
    Instead of using use lib and fiddling with environment variables, is there a reason you can't just set the environment variable PERL5LIB to whatever value is necessary?
Re: Problems with 'use lib'
by TomDLux (Vicar) on Aug 21, 2003 at 19:42 UTC

    The best solution is to use environment variables to modify the included path during development, or you could use perl -I ...

    If you're up-to-date with your Perl binary, there's also conditional modules:use if <cond>, MODULE qw/.../

    --
    TTTATCGGTCGTTATATAGATGTTTGCA

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: perlquestion [id://285370]
Approved by greenFox
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others drinking their drinks and smoking their pipes about the Monastery: (15)
As of 2013-05-23 15:16 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The best material for plates (tableware) is:









    Results (485 votes), past polls