Beefy Boxes and Bandwidth Generously Provided by pair Networks
Clear questions and runnable code
get the best and fastest answer
 
PerlMonks  

DigitalKitty's scratchpad

by DigitalKitty (Parson)
on Jun 02, 2004 at 00:42 UTC ( #358909=scratchpad: print w/ replies, xml ) Need Help??

CB database tool (work in progress)

use warnings; use strict; use LWP::Simple; use DBI; my $data = ''; my $dbh = ''; my $url = 'http://www.perlmonks.org/?node_id=207304'; my $pat = qr{ <author>(.*?)<\/author>.*?<text>(.*?)<\/text> }xs; $dbh = DBI->connect( "dbi:SQLite:dbname=C:\\testdb", "", "" ); $data = get( $url ); while ($data =~ m/$pat/msg) { my ($auth, $text) = ($1, $2); for( $text ) { s/[ ]+/ /g; s/^\s+//; s/\s+$//; } printf "%s: %s\n\n" , $auth , $text; $dbh->do('insert into monks values(?,?)', undef, $auth, $text ); }
use warnings; use strict; use Switch; my $dna = 'atctcttttcgtctgctttggggtttgtcctataggcta'; my $base = ''; my @bases = (); my $a = ''; my $c = ''; my $g = ''; my $t = ''; my $err = 0; my $total = 0; calc_base( $dna ); sub calc_base { my ( $dna ) = @_; print 'Please enter a base to calculate: '; chomp( $base = <STDIN> ); @bases = split '', $dna; $total = length $dna; for( @bases ) { ++$a if /a/; ++$c if /c/; ++$g if /g/; ++$t if /t/; ++$err if /[^acgt]/; } switch ( $base ) { case "a" { printf "The amount of adenosine in the sequence is %. +2f%%", ( ($a/$total) * 100); } case "c" { printf "The amount of cytosine in the sequence is %.2 +f%%", ( ($c/$total) * 100); } case "g" { printf "The amount of guanine in the sequence is %.2f +%%", ( ($g/$total) * 100); } case "t" { printf "The amount of thymidine in the sequence is %. +2f%%", ( ($t/$total) * 100); } } }
Log In?
Username:
Password:

What's my password?
Create A New User
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others rifling through the Monastery: (12)
As of 2014-12-26 19:19 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    Is guessing a good strategy for surviving in the IT business?





    Results (174 votes), past polls