Beefy Boxes and Bandwidth Generously Provided by pair Networks
laziness, impatience, and hubris
 
PerlMonks  

Re: nested foreach loop, match DNA sequences and calculate score

by Cristoforo (Deacon)
on Dec 18, 2012 at 19:34 UTC ( #1009448=note: print w/ replies, xml ) Need Help??


in reply to nested foreach loop, match DNA sequences and calculate score

To show another way to calculate the matches.

#!/usr/bin/perl use strict; use warnings; my $fasta1 = 'GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGC +CAAC'; my $fasta2 = 'ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCA +GCAG'; my $matched = ($fasta1 ^ $fasta2) =~ tr/\0//; my $non_match = length($fasta1) - $matched; print "matched: $matched\n"; print "non_matched: $non_match\n";
This prints:
matched: 15 non_matched: 45


Comment on Re: nested foreach loop, match DNA sequences and calculate score
Select or Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1009448]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others contemplating the Monastery: (11)
As of 2015-07-29 17:36 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









    Results (266 votes), past polls