Beefy Boxes and Bandwidth Generously Provided by pair Networks
There's more than one way to do things
 
PerlMonks  

Re: nested foreach loop, match DNA sequences and calculate score

by Cristoforo (Deacon)
on Dec 18, 2012 at 19:34 UTC ( #1009448=note: print w/ replies, xml ) Need Help??


in reply to nested foreach loop, match DNA sequences and calculate score

To show another way to calculate the matches.

#!/usr/bin/perl use strict; use warnings; my $fasta1 = 'GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGC +CAAC'; my $fasta2 = 'ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCA +GCAG'; my $matched = ($fasta1 ^ $fasta2) =~ tr/\0//; my $non_match = length($fasta1) - $matched; print "matched: $matched\n"; print "non_matched: $non_match\n";
This prints:
matched: 15 non_matched: 45


Comment on Re: nested foreach loop, match DNA sequences and calculate score
Select or Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1009448]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others musing on the Monastery: (14)
As of 2014-12-19 15:06 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    Is guessing a good strategy for surviving in the IT business?





    Results (84 votes), past polls