Beefy Boxes and Bandwidth Generously Provided by pair Networks
Syntactic Confectionery Delight
 
PerlMonks  

Re: nested foreach loop, match DNA sequences and calculate score

by Cristoforo (Deacon)
on Dec 18, 2012 at 19:34 UTC ( #1009448=note: print w/replies, xml ) Need Help??


in reply to nested foreach loop, match DNA sequences and calculate score

To show another way to calculate the matches.
#!/usr/bin/perl use strict; use warnings; my $fasta1 = 'GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGC +CAAC'; my $fasta2 = 'ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCA +GCAG'; my $matched = ($fasta1 ^ $fasta2) =~ tr/\0//; my $non_match = length($fasta1) - $matched; print "matched: $matched\n"; print "non_matched: $non_match\n";
This prints:
matched: 15 non_matched: 45

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1009448]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others chanting in the Monastery: (7)
As of 2016-09-27 14:10 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?
    Extraterrestrials haven't visited the Earth yet because:







    Results (506 votes). Check out past polls.