Beefy Boxes and Bandwidth Generously Provided by pair Networks
Keep It Simple, Stupid

Re: Extracting IDs from fasta file

by 2teez (Vicar)
on Mar 01, 2013 at 12:36 UTC ( #1021239=note: print w/replies, xml ) Need Help??

in reply to Extracting IDs from fasta file

Hi MBobur,
If I must add my voice to the wonderful wisdom, you have gotten before now.
Which would you rather prefer

  • To follow both
    marto's wisdom in Re: intron length to one of your post,
    and that of
    blue_cowdawg which says:
    fellow monk, there are better ways to ask homework questions. First step in my opinion is to try and solve the problem yourself. If it works, you've accomplished something truly great. If it crashes, burns and dies in the flames then you'll accomplish even greater things by posting a well titled and formatted question to Seekers of Perl Wisdom so that others in a similar predicament as yours can learn by it. At least, in my honest opinion, is how Perl Monks is supposed to work.
  • OR, I write this for you:
    use warnings; use strict; while (<DATA>) { print $1, $/ if m[^>(?=(.+?)\|)]; } __DATA__ >BTBSCRYR|IV|123123-43245273 tgcaccaaacatgtctaaagctggaaccaaaattactttct +ttgaagacaaaaaggccgccactatgacagcgattgcgactgtgcagatttccacatgtacctgagccg +ctg >BTBSCRYADASR|IV|123123-43245273
    And you have to keep asking, what which stand for and how to do the next assignment/ or project?

I think, you will grow and become a better Perl user, even helping others if you choose to follow the wisdom(s) of those who has walked your path before now.
However, if all these doesn't make sense then you can check this: How do I post a question effectively?

If you tell me, I'll forget.
If you show me, I'll remember.
if you involve me, I'll understand.
--- Author unknown to me

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1021239]
[choroba]: Corion One day, you'll implement the support for window functions in SQLite.
[Corion]: choroba: I admit I've thought about it ;) But I think I'll sooner hack up the Pg parser library to spit out a good parse tree and then hack that up to create Perl code :)
[Corion]: But back when I last looked at the VM of SQLite it seemed way to basic to me to implement anything in it....

How do I use this? | Other CB clients
Other Users?
Others studying the Monastery: (15)
As of 2018-03-22 12:40 GMT
Find Nodes?
    Voting Booth?
    When I think of a mole I think of:

    Results (274 votes). Check out past polls.