Beefy Boxes and Bandwidth Generously Provided by pair Networks httptech
Don't ask to ask, just ask
 
PerlMonks  

Re: [OT]: How do I stop appending data: Dispatch translation

by AnomalousMonk (Prior)
on Mar 07, 2013 at 22:09 UTC ( #1022308=note: print w/ replies, xml ) Need Help??


in reply to How do I stop appending data

This is OT, but here's an approch to doing the actual translation by lookup rather than by a large, nested  if...elsif in a subroutine. Should be faster. Some attempts at data validation are made, but no guarantee this is bulletproof. Uses state feature and the  // operator, both from 5.10+; if you don't have 5.10, let me know and I'll make work-arounds.

use warnings; use strict; use feature qw(state); use Test::More # tests => ?? + 1 # Test::NoWarnings add 1 test 'no_plan' ; use Test::NoWarnings; use Data::Dump; my @codons = qw(/GC./ /TG[TC]/ /GA[TC]/ /GA[AG]/); my @aminos = qw( A C D E); push @codons, qw(/TT[TC]/ /GG./ /CA[TC]/ /AT[TCA]/); push @aminos, qw( F G H I); push @codons, qw(/AA[AG]/ /TT[AG]|CT./ /ATG/ /AA[TC]/); push @aminos, qw( K L M N); push @codons, qw(/CC./ /CA[AG]/ /CG.|AG[AG]/ /TC.|AG[TC]/); push @aminos, qw( P Q R S); push @codons, qw(/AC./ /GT./ /TGG/ /TA[TC]/ /TA[AG]|TGA/); push @aminos, qw( T V W Y _); die qq{lists of codons and aminos not the same length} if @codons != @aminos; my %xlate; # translate base triplets to amino for (0 .. $#codons) { add_to_table(\%xlate, codons_to_amino($codons[$_], $aminos[$_])), } # dd \%xlate; # FOR DEBUG - see what we got for my $ar_vector ( # base sequence expected protein [ qw(GTTACTGAGTGTGGTTGGCAGACTGCTGGTTGCCGTATGTAT VTECGWQTAGCRMY) ], [ qw(CTTTCTCATTGTGATGTTAAGGATTGGATGTGCTGGCTTCTG LSHCDVKDWMCWLL) ], [ qw(GCTTGGACTTGTGTTGAGATTGATGGTCATTTCTCTATGAAT AWTCVEIDGHFSMN) ], ) { my ($bases, $protein) = @$ar_vector; is encode(\%xlate, $bases), $protein, qq{'$bases' -> '$protein'}; } # subroutines ###################################################### sub encode { my ($hr_xlate, $bases, ) = @_; $bases = canonicalize($bases); die qq{number of bases not multiple of 3} if length($bases) % 3; # translate NON-overlapping base triplets to aminos. $bases =~ s{ (...) }{ $hr_xlate->{$1} // '*' }xmsge; return $bases; # bases now translated to protein sequence } # subroutines for building translation table. sub canonicalize { return uc $_[0]; } sub codons_to_amino { my ($codon_pat, # pattern of codon(s) $amino, # amino codon(s) map to ) = @_; $codon_pat = canonicalize($codon_pat); $amino = canonicalize($amino); # translate regex to glob form. state $bases = canonicalize('ATCG'); state $base = qr{ [$bases] }xms; state $any = qr{ \. }xms; state $some = qr{ \[ $base{2,3} \] }xms; state $codon = qr{ $base $base (?: $base | $any | $some) }xms; state $triplet = qr{ \A $base{3} \z }xms; state $any_glob = '{' . join(q{,}, split '', $bases) . '}'; my @codon_groups = $codon_pat =~ m{ $codon }xmsg; for (@codon_groups) { s{ $any }{$any_glob}xmsg; s{ ($some) }{ some_glob($1) }xmsge; } my @triplets = glob(qq{@codon_groups}); for (@triplets) { die qq{'$_' not a triplet} if $_ !~ $triplet; } return $amino, @triplets; } sub some_glob { my ($some_pat, # 2-3 bases in regex class: [ATC] [AT] ) = @_; my $bases = join q{,}, $some_pat =~ m{ \w }xmsg; return qq{{$bases}}; } sub add_to_table { my ($hr_table, $amino, @triplets, ) = @_; for my $triplet (@triplets) { die qq{'$triplet' already in table} if exists $hr_table->{$triplet}; $hr_table->{$triplet} = $amino; } }


Comment on Re: [OT]: How do I stop appending data: Dispatch translation
Select or Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1022308]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others imbibing at the Monastery: (9)
As of 2013-05-19 17:45 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The best material for plates (tableware) is:









    Results (397 votes), past polls