Beefy Boxes and Bandwidth Generously Provided by pair Networks
laziness, impatience, and hubris
 
PerlMonks  

Re: Extracting multiple rows in a text file with a regex.

by Skeeve (Vicar)
on Jul 28, 2013 at 09:02 UTC ( #1046723=note: print w/replies, xml ) Need Help??


in reply to Extracting multiple rows in a text file with a regex.

If you don't want to "slurp" in the whole file at once:

my $name; my $seq; while (<DATA>) { chomp; if (s/^Name:\s*//) { $name= $_; next; } if (s/^Nucleotide Sequence:\s*//) { $seq= $_; while (<DATA>) { last if /^s*$/; chomp; $seq.= $_; } print "$name\n$seq\n\n"; } } __DATA__ GeneID: 1002 Name: cadherin 4, type 1, R-cadherin (retinal) Chromo: 20 Cytoband: 20q13.3 Nucleotide Sequence: atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggc acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagcagtacacag cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa GeneID: 10077 Name: tetraspanin 32 Chromo: 11 Cytoband: 11p15.5 Nucleotide Sequence: atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc GeneID: 10078 Name: tumor suppressing subtransferable candidate 4 Chromo: 11 Cytoband: 11p15.5 Nucleotide Sequence: atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa

s$$([},&%#}/&/]+}%&{})*;#$&&s&&$^X.($'^"%]=\&(|?*{%
+.+=%;.#_}\&"^"-+%*).}%:##%}={~=~:.")&e&&s""`$''`"e

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1046723]
help
Chatterbox?
[james28909]: @choroba yes they do but for some reasom when i try to pipe the output of youtube-dl to ffmpeg, it fails. hence the work around lol
[RonW]: james28909: Interesting trick
[choroba]: The theme is "High-end Perl", so both my talks are antitheses: "Low-end Perl" and "How to almost win a T-shirt in a programming contest"
[RonW]: I wonder if that's a CMD.exe limitation or a Windows limitation
[james28909]: what i am trying to accomplish is piping the output of ffmpeg to yet another encryption routine using libsodium. and hopefully once that is done i will be able to forward the packets to discord servers
[RonW]: choroba: Please define "high end" and "low end"
[LanX]: choroba: subversive (as usual ;)
[james28909]: i dunno, if i didnt have so little experience in linux i would swap. but it would be to much of a learning curve for me right now.
[choroba]: Low-end is defined as the Perl that generates millions of income
[choroba]: sorry, that's high-end, of coursse

How do I use this? | Other CB clients
Other Users?
Others chanting in the Monastery: (16)
As of 2017-05-22 21:29 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?