Re: Extracting multiple rows in a text file with a regex.

If I may add this. You can step through your data line by line getting what you want, then to get all your "Nucleotide Sequence", since you have a "blanck" line used as delimiter, then you could use perl "flip-flop" operator (..) as it is called like so:

use warnings;
use strict;


while(<DATA>){
  if(/Name:\s+?(.+?)$/){
    print $1,$/;
  }
  if(/Nucleotide Sequence/../^\s*$/){ # use "flip-flop" operator
     s/.*:\s+?//;  # remove the Nucleotide Sequence to :,then print
    print
  }
}

__DATA__
GeneID: 1002
Name: cadherin 4, type 1, R-cadherin (retinal)
Chromo: 20
Cytoband: 20q13.3
Nucleotide Sequence: atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggc
acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagcagtacacag
cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa

GeneID: 10077
Name: tetraspanin 32
Chromo: 11
Cytoband: 11p15.5
Nucleotide Sequence: atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc

GeneID: 10078
Name: tumor suppressing subtransferable candidate 4
Chromo: 11
Cytoband: 11p15.5
Nucleotide Sequence: atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa
[download]

Produces ..

cadherin 4, type 1, R-cadherin (retinal)
atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggc
acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagcagtacacag
cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa

tetraspanin 32
atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc

tumor suppressing subtransferable candidate 4
atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa
[download]

If you tell me, I'll forget.
If you show me, I'll remember.
if you involve me, I'll understand.
--- Author unknown to me

Comment on Re: Extracting multiple rows in a text file with a regex. Select or Download Code

Replies are listed 'Best First'.
Re^2: Extracting multiple rows in a text file with a regex. by Skeeve (Parson) on Jul 29, 2013 at 06:05 UTC
I'd move the flip-flop operator to the top of the loop. Testing for "Name", while the "flip" didn't "flop" is useless. Additionally I'd either make the second "if" an "elsif" or leave the "if" block with a "next" in order not to check more than required. `s$$([},&%#}/&/]+}%&{});#$&&s&&$^X.($'^"%]=\&(\|?{%` `+`.+=%;.#_}\&"^"-+%*).}%:##%}={~=~:.")&e&&s""`$''`"e	[reply] [d/l] [select]


No such thing as a small change
	PerlMonks