Beefy Boxes and Bandwidth Generously Provided by pair Networks
laziness, impatience, and hubris
 
PerlMonks  

Re^11: Comparing 2 different-sized strings

by BrowserUk (Pope)
on Aug 18, 2013 at 13:41 UTC ( #1049909=note: print w/ replies, xml ) Need Help??


in reply to Re^10: Comparing 2 different-sized strings
in thread Comparing 2 different-sized strings

If I am searching for 2 sequences within the same haystack, and what separates the 2 sequences is always a "T" followed by one other nucleotide (either A,G,C,or T),

Could you explain that a bit more?

I get that you are looking for ???...????T[acgt]???..???; but that criteria will match everywhere a T occurs in a sequence, other than if it is the first, or second or third last, characters in the sequence. And without some constraints on the lengths of the pre & post T sequence length, there would be multiple (100s or 1000s or millions) possible matches at every T position.


With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.


Comment on Re^11: Comparing 2 different-sized strings
Download Code
Re^12: Comparing 2 different-sized strings
by AdrianJ217 (Novice) on Aug 18, 2013 at 16:19 UTC
    Hi, I'm not just looking for the T. For example, if I have the following sequence:
    $hay = AACCCAGGATGCGCCATGCAGGACACAGGACGCCACGGAA $nee1 = AGGA $nee2 = CGCCAC
    What I want is the following in regular expression:
    $hay =~ /($nee1)T[ATGC]($nee2)/
    So I only want $nee1 when it is directly followed by a T, some other nucleotide and $nee2. I don't want $nee1 and $nee2 anywhere else.
      What I want is the following in regular expression: $hay =~ /($nee1)T[ATGC]($nee2)/

      Then use the regular expression. It is perfect for that usage.

      fuzzyMatch() is not designed for that type of matching.


      With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
      Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
      "Science is about questioning the status quo. Questioning authority".
      In the absence of evidence, opinion is indistinguishable from prejudice.
        I would use the regular expression except the problem is that there may be up to 2 mismatches in $nee1 and/or $nee2. In that case I need to use the fuzzyMatch subroutine don't I? Is there a way to incorporate the fuzzyMatch subroutine, which is perfect for mismatches, into the regular expression?

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1049909]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others chanting in the Monastery: (9)
As of 2014-12-29 02:58 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    Is guessing a good strategy for surviving in the IT business?





    Results (184 votes), past polls