Beefy Boxes and Bandwidth Generously Provided by pair Networks
Do you know where your variables are?

Re: merge sequences with new sequence insertion

by Kenosis (Priest)
on Nov 26, 2013 at 20:41 UTC ( #1064472=note: print w/ replies, xml ) Need Help??

in reply to merge sequences with new sequence insertion

Perhaps the following will be helpful:

perl -ne 'chomp; $x=0; print if /^(?<!>)\S+$/' input_file.txt >output_ +file.txt

Output on your dataset:

tttgctcggaggggatcgaaaacacttccttattatacaggtaaaccgtatttggataaagctcggaggg +gatcccct

Edit: Sorry... Didn't notice the "insert" spec.

Comment on Re: merge sequences with new sequence insertion
Select or Download Code

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1064472]
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others browsing the Monastery: (9)
As of 2015-03-06 00:19 GMT
Find Nodes?
    Voting Booth?

    When putting a smiley right before a closing parenthesis, do you:

    Results (155 votes), past polls