Beefy Boxes and Bandwidth Generously Provided by pair Networks
XP is just a number

Re: merge sequences with new sequence insertion

by Kenosis (Priest)
on Nov 26, 2013 at 20:41 UTC ( #1064472=note: print w/replies, xml ) Need Help??

in reply to merge sequences with new sequence insertion

Perhaps the following will be helpful:

perl -ne 'chomp; $x=0; print if /^(?<!>)\S+$/' input_file.txt >output_ +file.txt

Output on your dataset:

tttgctcggaggggatcgaaaacacttccttattatacaggtaaaccgtatttggataaagctcggaggg +gatcccct

Edit: Sorry... Didn't notice the "insert" spec.

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1064472]
[Discipulus]: still happy Happy-the-monk? even in 2018? good for you.. ;=)
[choroba]: Good morning!
[Eily]: Hi!
[Happy-the-monk]: Discipulus: si!
[Eily]: Discipulus 2018 has to be better than 2017. The latter was kinda odd, but not we got even :D

How do I use this? | Other CB clients
Other Users?
Others pondering the Monastery: (5)
As of 2018-01-23 08:48 GMT
Find Nodes?
    Voting Booth?
    How did you see in the new year?

    Results (242 votes). Check out past polls.
