Beefy Boxes and Bandwidth Generously Provided by pair Networks
laziness, impatience, and hubris
 
PerlMonks  

Re: merge sequences with new sequence insertion

by Kenosis (Priest)
on Nov 26, 2013 at 20:41 UTC ( #1064472=note: print w/ replies, xml ) Need Help??


in reply to merge sequences with new sequence insertion

Perhaps the following will be helpful:

perl -ne 'chomp; $x=0; print if /^(?<!>)\S+$/' input_file.txt >output_ +file.txt

Output on your dataset:

tttgctcggaggggatcgaaaacacttccttattatacaggtaaaccgtatttggataaagctcggaggg +gatcccct

Edit: Sorry... Didn't notice the "insert" spec.


Comment on Re: merge sequences with new sequence insertion
Select or Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1064472]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others romping around the Monastery: (10)
As of 2014-07-24 17:53 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    My favorite superfluous repetitious redundant duplicative phrase is:









    Results (163 votes), past polls