Beefy Boxes and Bandwidth Generously Provided by pair Networks
Syntactic Confectionery Delight
 
PerlMonks  

Re: merge sequences with new sequence insertion

by Kenosis (Priest)
on Nov 26, 2013 at 20:41 UTC ( #1064472=note: print w/ replies, xml ) Need Help??


in reply to merge sequences with new sequence insertion

Perhaps the following will be helpful:

perl -ne 'chomp; $x=0; print if /^(?<!>)\S+$/' input_file.txt >output_ +file.txt

Output on your dataset:

tttgctcggaggggatcgaaaacacttccttattatacaggtaaaccgtatttggataaagctcggaggg +gatcccct

Edit: Sorry... Didn't notice the "insert" spec.


Comment on Re: merge sequences with new sequence insertion
Select or Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1064472]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others rifling through the Monastery: (6)
As of 2015-07-30 04:53 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









    Results (270 votes), past polls