Beefy Boxes and Bandwidth Generously Provided by pair Networks
Problems? Is your data what you think it is?
 
PerlMonks  

Re: Create the reverse complement (OT: meaning / use of "reverse complement")

by ww (Bishop)
on Feb 19, 2014 at 16:55 UTC ( #1075492=note: print w/ replies, xml ) Need Help??


in reply to Create the reverse complement DNA sequence without pattern matching and reverse built-in function?

Could some kind soul explain how "reverse complement" works? Is is not the same as "reverse? -- ie, is NOT one word or the other redundant?
Update: Has been explained! See below and the replies from BrowserUK and kcott

And if that's a bit fuzzy around the edges (yeah, it is, IMO), code to illustrate why I'm puzzled with OP's use of the phrase "reverse complement" and its adoption by others:

#!/usr/bin/perl use 5.016; use warnings; # 1075463 my $seq="ACGGGAGGACGGGAAAATTACTACGGCATTAGC"; say "Initial \$seq is: $seq"; say "Reverse sequence is: " . reverse($seq); my @seq = split(/\b/, $seq); my $comp; while (@seq) { $comp .= pop(@seq); } print "Complement is: $comp\n"; my $reverse = reverse($comp); print "Reverse complement is:$reverse\n"; =head OUTPUT: Initial $seq is: ACGGGAGGACGGGAAAATTACTACGGCATTAGC Reverse sequence is: CGATTACGGCATCATTAAAAGGGCAGGAGGGCA Complement is: ACGGGAGGACGGGAAAATTACTACGGCATTAGC # per OP's use, + I think Reverse complement is:CGATTACGGCATCATTAAAAGGGCAGGAGGGCA =cut

On-line dictionaries tend to mention the mathematics use only in geometric terms. Is my understanding that the OP's phrase would be better written and less ambiguous using just one of its two terms?

Update:

/me headslaps! Duh! Ignored the "double helix" fundamental! Thanks, obeisances and + +s to both BrowserUK and kcott.

Come, let us reason together: Spirit of the Monastery


Comment on Re: Create the reverse complement (OT: meaning / use of "reverse complement")
Download Code
Re^2: Create the reverse complement (OT: meaning / use of "reverse complement")
by BrowserUk (Pope) on Feb 19, 2014 at 17:02 UTC

    Google shows that is a well established term in genomics.


    With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
    Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
    "Science is about questioning the status quo. Questioning authority".
    In the absence of evidence, opinion is indistinguishable from prejudice.
Re^2: Create the reverse complement (OT: meaning / use of "reverse complement")
by kcott (Abbot) on Feb 19, 2014 at 17:48 UTC

    I'll attempt to describe this without using any biological references (therefore, highly oversimplified).

    DNA is made up of long strands (sequences) of just four building blocks (given the initials A, C, G and T). Here's an example sequence:

    A | C | G | T | G

    The sequence here is ACGTG; the reverse sequence would be that read from the other end, i.e. GTGCA.

    DNA strands form pairs. Each of the building blocks pairs with only one of the other building blocks: A with T and C with G (and vice versa). Knowing the sequence of one strand, the complementary sequence is easily determined:

    A==T | | C==G | | G==C | | T==A | | G==C

    So, the complement of ACGTG is TGCAC; and the reverse complement is just that read from the other end, i.e. CACGT.

    As I said, that's highly oversimplified but hopefully is enough to explain the terms.

    -- Ken

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1075492]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others cooling their heels in the Monastery: (6)
As of 2014-07-23 00:46 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    My favorite superfluous repetitious redundant duplicative phrase is:









    Results (130 votes), past polls