Beefy Boxes and Bandwidth Generously Provided by pair Networks
go ahead... be a heretic
 
PerlMonks  

Re^3: how to access elements in perl

by BrowserUk (Pope)
on May 23, 2014 at 14:47 UTC ( #1087221=note: print w/ replies, xml ) Need Help??


in reply to Re^2: how to access elements in perl
in thread how to access elements in perl

Hey if we have to print only those regions of range which shows count of C more than 50 then what we have to include in this code written above ????

Your question tells you everything you need to know:

if( $counts{ C } > 50 ) { printf "range: %d .. %d A:%d C:%d G:%d T:%d\n", $offset, $offset+199, @counts{ qw[ A C G T ] }; }

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.


Comment on Re^3: how to access elements in perl
Download Code
Replies are listed 'Best First'.
Re^4: how to access elements in perl
by grewal7634 (Novice) on May 27, 2014 at 11:21 UTC

    Hey i have done following modifications in above code, but i need some more help from you to modify it a little bit.

    #! perl -slw use strict; my $dna = do{ local $/; <DATA> }; $dna =~ tr[\n][]d; my$len = length $dna; my %counts; ++$counts{ substr $dna, $_, 1 } for 0 ..199; # output.txt file will be created in which all of your results will be + stored. You can change the name of file as your wish. open(PAGE,">output.txt") || die"Can't open Outfile\n"; for my $offset ( 0 .. length( $dna )-200 ) { if ((($counts{'G'}+$counts{'C'})/(200)*100) > 40) { printf PAGE "range: %d .. %d A:%d C:%d G:%d T:%d G+C:%d GC%%:%d E +:%d R:%.1f\n", $offset, $offset+199, @counts{ qw[ A C G T ] }, $coun +ts{'G'}+$counts{'C'}, ($counts{'G'}+$counts{'C'})/(200)*100, ($len)*5 +/100, (($counts{'G'}+$counts{'C'})/(200)*100)/(($len)*5/100)*100; } --$counts{ substr $dna, $offset, 1 }; ++$counts{ substr $dna, $offset+200, 1 }; } print "The length of entire DNA sequence is = $len\n"; __DATA__ GATCTAAATGCTAGCTAGCTAGCTAGCTGGAATCCTCAATAGCTCAATCGATTCAATGCGCGCGTATAAG GGTAAGCGGTCCGCTACGATCCATCACATTCCACAATTAAAATTACCAAAATCGCATTCAAGGTCTCACA TAAAGAGTGCAGCTGCATCGATTGTAAATGCATAGATACATCATTAAATCTACAACACAGTTGACAAGAA CGTCAAAACCGTATTGTTTCAAAACTAAGGTCAAAAAAACCAAGCAGCATTTTGTTTTTGAAAATATACC CAAATATGTGCTAGCTACGACAAATAGCAATGTATTTATCCATAGCGATCGCGGACCTAACTTTCGCAAA AAATGCCAAGCCTAACCCAGACAAGACTCTCGCAATGAAATCGGAAAACAATAGCACTATGATGTATATT TCGTTCAGTTTTTGGTGAAAGAGCTCGAAGGTTTCATTAACGATAATCGCAAGGGCTAGCGAGCCTTTGG AAGCTGTCCTGTGACACGTTGACAATTCAATATATTACACTACATATTTTTACATATTATTTATATAATA TATAAGCATCGATGCAGCGAATCGTTCTTATTTCAATATGTACGAGTGTTTTGCGATACAAAATATCCCA ACGAGCACATTTCAGGGCATTTTATGAGACCGATCTGACGAGTCTGACGCTCGCAAAAGGCTTTTATGTT AAATGCAAATAAAAGATCGAGCAGTCTGACGTATACATGGAATTGCCTTCATTGCAAGAAAACAAATTTT CTCTAAACTGTCCTAACTGGCTGACTGATTGGTTAATAAACGCACAGAGTTAGAAAGCTGACACTTGAAC TTTAAGCAGCAGCGAGCAGCGTAATTTATATGATGAGGTCATGGAAATTTTACCGACATGTATGGTAAAT ACAAATTGTTTGGTAGTTCCGGTGCGCCTAAGACGCGTAGATTATCCGATCGGCTCTAAACTTATTTTCG +
    output: range: 0 .. 199 A:69 C:47 G:35 T:49 G+C:82 GC%:41 E:49 R:83.7 range: 1 .. 200 A:69 C:47 G:34 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 2 .. 201 A:68 C:47 G:34 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 3 .. 202 A:68 C:47 G:35 T:50 G+C:82 GC%:41 E:49 R:83.7 range: 4 .. 203 A:69 C:46 G:35 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 5 .. 204 A:69 C:47 G:35 T:49 G+C:82 GC%:41 E:49 R:83.7 range: 6 .. 205 A:69 C:47 G:35 T:49 G+C:82 GC%:41 E:49 R:83.7 range: 7 .. 206 A:69 C:47 G:35 T:49 G+C:82 GC%:41 E:49 R:83.7 range: 8 .. 207 A:68 C:47 G:36 T:49 G+C:83 GC%:41 E:49 R:84.7 range: 9 .. 208 A:69 C:47 G:36 T:48 G+C:83 GC%:41 E:49 R:84.7 range: 10 .. 209 A:70 C:47 G:35 T:48 G+C:82 GC%:41 E:49 R:83.7 range: 11 .. 210 A:70 C:47 G:35 T:48 G+C:82 GC%:41 E:49 R:83.7 range: 12 .. 211 A:70 C:47 G:36 T:47 G+C:83 GC%:41 E:49 R:84.7 range: 13 .. 212 A:69 C:47 G:36 T:48 G+C:83 GC%:41 E:49 R:84.7 range: 14 .. 213 A:69 C:48 G:35 T:48 G+C:83 GC%:41 E:49 R:84.7 range: 15 .. 214 A:70 C:47 G:35 T:48 G+C:82 GC%:41 E:49 R:83.7 range: 16 .. 215 A:71 C:47 G:35 T:47 G+C:82 GC%:41 E:49 R:83.7 range: 17 .. 216 A:71 C:47 G:35 T:47 G+C:82 GC%:41 E:49 R:83.7 range: 18 .. 217 A:72 C:47 G:34 T:47 G+C:81 GC%:40 E:49 R:82.7 range: 19 .. 218 A:72 C:47 G:34 T:47 G+C:81 GC%:40 E:49 R:82.7 range: 20 .. 219 A:72 C:48 G:34 T:46 G+C:82 GC%:41 E:49 R:83.7 range: 21 .. 220 A:71 C:48 G:35 T:46 G+C:83 GC%:41 E:49 R:84.7 range: 22 .. 221 A:71 C:48 G:34 T:47 G+C:82 GC%:41 E:49 R:83.7 range: 23 .. 222 A:72 C:47 G:34 T:47 G+C:81 GC%:40 E:49 R:82.7 range: 24 .. 223 A:72 C:47 G:34 T:47 G+C:81 GC%:40 E:49 R:82.7 range: 25 .. 224 A:71 C:47 G:34 T:48 G+C:81 GC%:40 E:49 R:82.7 range: 26 .. 225 A:71 C:47 G:34 T:48 G+C:81 GC%:40 E:49 R:82.7 range: 276 .. 475 A:69 C:43 G:38 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 277 .. 476 A:69 C:43 G:38 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 278 .. 477 A:69 C:43 G:38 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 279 .. 478 A:69 C:42 G:39 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 280 .. 479 A:69 C:42 G:39 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 281 .. 480 A:69 C:41 G:40 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 282 .. 481 A:69 C:41 G:40 T:50 G+C:81 GC%:40 E:49 R:82.7 range: 283 .. 482 A:68 C:41 G:41 T:50 G+C:82 GC%:41 E:49 R:83.7 range: 284 .. 483 A:67 C:42 G:41 T:50 G+C:83 GC%:41 E:49 R:84.7 range: 285 .. 484 A:67 C:43 G:41 T:49 G+C:84 GC%:42 E:49 R:85.7 range: 286 .. 485 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 287 .. 486 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 288 .. 487 A:66 C:43 G:40 T:51 G+C:83 GC%:41 E:49 R:84.7 range: 289 .. 488 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 290 .. 489 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 291 .. 490 A:67 C:42 G:41 T:50 G+C:83 GC%:41 E:49 R:84.7 range: 292 .. 491 A:68 C:42 G:41 T:49 G+C:83 GC%:41 E:49 R:84.7 range: 293 .. 492 A:67 C:42 G:42 T:49 G+C:84 GC%:42 E:49 R:85.7 range: 294 .. 493 A:67 C:43 G:41 T:49 G+C:84 GC%:42 E:49 R:85.7 range: 295 .. 494 A:67 C:42 G:41 T:50 G+C:83 GC%:41 E:49 R:84.7 range: 296 .. 495 A:67 C:42 G:42 T:49 G+C:84 GC%:42 E:49 R:85.7 range: 297 .. 496 A:66 C:42 G:42 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 298 .. 497 A:66 C:42 G:42 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 299 .. 498 A:66 C:43 G:41 T:50 G+C:84 GC%:42 E:49 R:85.7 range: 300 .. 499 A:65 C:43 G:41 T:51 G+C:84 GC%:42 E:49 R:85.7 range: 301 .. 500 A:65 C:42 G:42 T:51 G+C:84 GC%:42 E:49 R:85.7 range: 302 .. 501 A:64 C:42 G:42 T:52 G+C:84 GC%:42 E:49 R:85.7 range: 303 .. 502 A:63 C:42 G:43 T:52 G+C:85 GC%:42 E:49 R:86.7 range: 304 .. 503 A:63 C:42 G:43 T:52 G+C:85 GC%:42 E:49 R:86.7 range: 305 .. 504 A:63 C:43 G:43 T:51 G+C:86 GC%:43 E:49 R:87.8 range: 306 .. 505 A:63 C:43 G:43 T:51 G+C:86 GC%:43 E:49 R:87.8 range: 307 .. 506 A:63 C:44 G:42 T:51 G+C:86 GC%:43 E:49 R:87.8 range: 308 .. 507 A:63 C:43 G:43 T:51 G+C:86 GC%:43 E:49 R:87.8 range: 309 .. 508 A:62 C:43 G:43 T:52 G+C:86 GC%:43 E:49 R:87.8 range: 310 .. 509 A:61 C:43 G:43 T:53 G+C:86 GC%:43 E:49 R:87.8 range: 311 .. 510 A:61 C:43 G:44 T:52 G+C:87 GC%:43 E:49 R:88.8 range: 312 .. 511 A:62 C:43 G:43 T:52 G+C:86 GC%:43 E:49 R:87.8 range: 313 .. 512 A:62 C:44 G:43 T:51 G+C:87 GC%:43 E:49 R:88.8 range: 314 .. 513 A:62 C:44 G:43 T:51 G+C:87 GC%:43 E:49 R:88.8 range: 315 .. 514 A:63 C:44 G:43 T:50 G+C:87 GC%:43 E:49 R:88.8 range: 316 .. 515 A:63 C:44 G:43 T:50 G+C:87 GC%:43 E:49 R:88.8 range: 317 .. 516 A:63 C:44 G:43 T:50 G+C:87 GC%:43 E:49 R:88.8 range: 318 .. 517 A:62 C:45 G:43 T:50 G+C:88 GC%:44 E:49 R:89.8 range: 319 .. 518 A:63 C:45 G:43 T:49 G+C:88 GC%:44 E:49 R:89.8 range: 320 .. 519 A:64 C:44 G:43 T:49 G+C:87 GC%:43 E:49 R:88.8 range: 321 .. 520 A:64 C:43 G:43 T:50 G+C:86 GC%:43 E:49 R:87.8 range: 322 .. 521 A:64 C:43 G:43 T:50 G+C:86 GC%:43 E:49 R:87.8 range: 323 .. 522 A:64 C:43 G:43 T:50 G+C:86 GC%:43 E:49 R:87.8 range: 324 .. 523 A:64 C:43 G:43 T:50 G+C:86 GC%:43 E:49 R:87.8 range: 325 .. 524 A:64 C:43 G:42 T:51 G+C:85 GC%:42 E:49 R:86.7 range: 326 .. 525 A:64 C:42 G:42 T:52 G+C:84 GC%:42 E:49 R:85.7 range: 327 .. 526 A:65 C:42 G:41 T:52 G+C:83 GC%:41 E:49 R:84.7 range: 328 .. 527 A:64 C:43 G:41 T:52 G+C:84 GC%:42 E:49 R:85.7 range: 329 .. 528 A:65 C:43 G:41 T:51 G+C:84 GC%:42 E:49 R:85.7 range: 330 .. 529 A:65 C:43 G:41 T:51 G+C:84 GC%:42 E:49 R:85.7 range: 331 .. 530 A:65 C:43 G:40 T:52 G+C:83 GC%:41 E:49 R:84.7 range: 332 .. 531 A:66 C:42 G:40 T:52 G+C:82 GC%:41 E:49 R:83.7 range: 333 .. 532 A:66 C:43 G:39 T:52 G+C:82 GC%:41 E:49 R:83.7 range: 334 .. 533 A:67 C:43 G:38 T:52 G+C:81 GC%:40 E:49 R:82.7 range: 335 .. 534 A:66 C:43 G:38 T:53 G+C:81 GC%:40 E:49 R:82.7 range: 602 .. 801 A:63 C:40 G:41 T:56 G+C:81 GC%:40 E:49 R:82.7 range: 654 .. 853 A:67 C:39 G:42 T:52 G+C:81 GC%:40 E:49 R:82.7 range: 655 .. 854 A:68 C:39 G:42 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 656 .. 855 A:68 C:39 G:42 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 657 .. 856 A:67 C:40 G:42 T:51 G+C:82 GC%:41 E:49 R:83.7 range: 658 .. 857 A:68 C:40 G:41 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 659 .. 858 A:67 C:40 G:42 T:51 G+C:82 GC%:41 E:49 R:83.7 range: 660 .. 859 A:67 C:40 G:42 T:51 G+C:82 GC%:41 E:49 R:83.7 range: 661 .. 860 A:67 C:39 G:43 T:51 G+C:82 GC%:41 E:49 R:83.7 range: 662 .. 861 A:67 C:39 G:42 T:52 G+C:81 GC%:40 E:49 R:82.7 range: 663 .. 862 A:67 C:39 G:42 T:52 G+C:81 GC%:40 E:49 R:82.7 range: 664 .. 863 A:68 C:39 G:42 T:51 G+C:81 GC%:40 E:49 R:82.7 range: 762 .. 961 A:61 C:36 G:45 T:58 G+C:81 GC%:40 E:49 R:82.7 range: 763 .. 962 A:61 C:35 G:46 T:58 G+C:81 GC%:40 E:49 R:82.7 range: 764 .. 963 A:60 C:36 G:46 T:58 G+C:82 GC%:41 E:49 R:83.7 range: 765 .. 964 A:59 C:36 G:46 T:59 G+C:82 GC%:41 E:49 R:83.7 range: 766 .. 965 A:58 C:37 G:46 T:59 G+C:83 GC%:41 E:49 R:84.7 range: 767 .. 966 A:58 C:37 G:46 T:59 G+C:83 GC%:41 E:49 R:84.7 range: 768 .. 967 A:59 C:37 G:46 T:58 G+C:83 GC%:41 E:49 R:84.7 range: 769 .. 968 A:60 C:37 G:46 T:57 G+C:83 GC%:41 E:49 R:84.7 range: 770 .. 969 A:61 C:37 G:46 T:56 G+C:83 GC%:41 E:49 R:84.7 range: 771 .. 970 A:61 C:37 G:46 T:56 G+C:83 GC%:41 E:49 R:84.7 range: 772 .. 971 A:61 C:37 G:46 T:56 G+C:83 GC%:41 E:49 R:84.7 range: 773 .. 972 A:61 C:36 G:46 T:57 G+C:82 GC%:41 E:49 R:83.7 range: 774 .. 973 A:62 C:36 G:46 T:56 G+C:82 GC%:41 E:49 R:83.7 range: 775 .. 974 A:61 C:36 G:46 T:57 G+C:82 GC%:41 E:49 R:83.7 range: 776 .. 975 A:60 C:36 G:46 T:58 G+C:82 GC%:41 E:49 R:83.7 range: 777 .. 976 A:59 C:36 G:46 T:59 G+C:82 GC%:41 E:49 R:83.7 range: 778 .. 977 A:59 C:35 G:46 T:60 G+C:81 GC%:40 E:49 R:82.7 range: 779 .. 978 A:59 C:36 G:46 T:59 G+C:82 GC%:41 E:49 R:83.7 range: 780 .. 979 A:59 C:36 G:46 T:59 G+C:82 GC%:41 E:49 R:83.7

    This code prints only those regions that have GC% more than 40%. i want to count GC only when there is G and C present together as GC or as CG, and not when G and C present randomly as CAGTGATC. After this i have to calculate GC%. Secondly i have to take my input from file, not to copy my input data in the script. Please help me to solve this.

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1087221]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others pondering the Monastery: (12)
As of 2015-07-07 23:19 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The top three priorities of my open tasks are (in descending order of likelihood to be worked on) ...









    Results (93 votes), past polls