Beefy Boxes and Bandwidth Generously Provided by pair Networks
Clear questions and runnable code
get the best and fastest answer
 
PerlMonks  

Re^3: Reading file into a hash (last record problem)

by LanX (Canon)
on May 28, 2014 at 15:14 UTC ( #1087669=note: print w/ replies, xml ) Need Help??


in reply to Re^2: Reading file into a hash
in thread Reading file into a hash

Thats a very common problem, you are trying to add a record only when the successor is to be parsed, but the last record has no successor (sic ;)!

Most people try to solve by repeating code to add the last record after the loop.

But it's much cleaner this way (avoiding a posteriori state logic)

use strict; use warnings; use Data::Dump; my $header; my %sequence; while ( my $line = <DATA> ){ chomp $line; if ( $line =~ /^>(.*)/ ) { $header = $1; } else { $sequence{$header} .= $line; } } dd \%sequence; __DATA__ >sequence_5849 CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC TCCCACTAATAATTCTGAGG >sequence_5959 CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT ATATCCATTTGTCAGCAGACACGC >sequence_0808 CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC TGGGAACCTGCGGGCAGTAGGTGGAAT
output
{ sequence_0808 => "CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGAC +CAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT", sequence_5849 => "CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTC +CGGCCTTCCCTCCCACTAATAATTCTGAGG", sequence_5959 => "CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCG +CCGAAGGTCTATATCCATTTGTCAGCAGACACGC", }

Cheers Rolf

( addicted to the Perl Programming Language)

update

a *general pattern* to solve such problems while staying DRY is to use references

if ( $line =~ /^(HEAD_PATTERN)/ ) { $data = \ $deeply{nested}{structure}{$1}; # reference data + } else { $$data .= $line; # derefrence data }

like this you don't need to repeat the path of a deeply nested data structure, which might vary in multiple dimensions

update
added some explanation


Comment on Re^3: Reading file into a hash (last record problem)
Select or Download Code

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://1087669]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others contemplating the Monastery: (6)
As of 2014-12-20 02:23 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    Is guessing a good strategy for surviving in the IT business?





    Results (95 votes), past polls