Generating mulitple random strings of a set length

[Kajed]

I am trying to generate random strings from a set string with all of them being the same length and can be found already present inside the known string.

 my $DNA = "AACCGTTAATGGGCATCGATGCTATGCGAGCT";

     $DNA_length = length($DNA);

     my $random_sequence = &random_sequence($DNA);
     my $random_position = &random_position($DNA_length);
     my $random_base = &mutate();

     $DNA[$random_sequence] = $DNA;
     my @DNA_array = split("", $DNA);
     print "$random_position\t$random_base\n";
     $DNA_array[$random_position] = $random_base;
     print join("", @DNA_array), "\n";

     sub random_sequence {
         my $sequence = m/\w*[ACTG]{5}*/;
         my $new_sequence = int(rand(scalar $sequence)
         return $sequence[$new_sequence];

     sub random_position {
         my ($seed) = @_;
         return int(rand($seed));
     }
     sub mutate {
         my @base_array = ('A','C','G','T');
         my $random_base = int(rand(scalar @base_array));
         return $base_array[$random_base];
     }

I can get the random replacement but i cannot get the random sequence that the replacement is supposed to occur in. I have searched for a similar problem but none that I found helped solve the problem.

[thomas895]

Have you even tried running your own code? How about use strict? Or use diagnostics?

To be specific, look at lines 3, 6, 9, and 16 of your sample.

[aaron_baugher]

I don't understand what your code is trying to do or why you talk about "replacements," but if you want to get a random substring from a longer string, why not just pick a random offset between 0 and the difference between the full string's length and the substring's length? Here's an iterator which does that:

#!/usr/bin/env perl
use 5.010; use warnings; use strict;

my $DNA = "AACCGTTAATGGGCATCGATGCTATGCGAGCT";

sub make_rand_getter {
    my $s = shift;
    my $sl = length $s;
    return sub {
        return substr $s, int rand($sl - $_[0]), $_[0];
    }
}

my $rstring = make_rand_getter($DNA);
say "3-letter string: " . $rstring ->(3);
say "7-letter string: " . $rstring ->(7);

[vinoth.ree]

1.where is your random_sequence function ending curly braces ? 
2.what you are trying to do in this line my $sequence = m/\w*[ACTG]{5}*/;
3.$DNA argument passed to the random_sequence function but not used in function.
4.$DNA get assigned scalar value and later accessing as array in this line $DNA[$random_sequence] = $DNA;

[edimusrex]

This could be one way to do it with less code.



#!/usr/bin/perl
use warnings; 
use strict;

my $DNA = "AACCGTTAATGGGCATCGATGCTATGCGAGCT";
my @rand = split("", $DNA);

my $num  = @rand;

my $max = 5;
my @word;

for (my $i=0; $i<$max; $i++) {
    my $x = int(rand($num))-1;
    push @word, $rand[$x];
}

print @word;


By setting the variable $max to the desired length of the out put string.<br/
Of course if you wanted to use the random word as a variable substitute the "print @word" with


my $ranWord = join("",@word);
print $ranWord;


or something along those lines to create a variable from the array contents