Re: Print A Sequence with Start codon and different Stop Codon

#!/usr/bin/perl

# http://perlmonks.org/?node_id=1146191

use strict;
use warnings;

my $sequence = 'AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAACGAA'
+;

$sequence =~ /(ATG.*?(?:TAG|TAA|TGA))(??{print "$1\n"})/;
[download]

which prints:

ATGGTTTCTCCCATCTCTCCATCGGCATAA
ATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGA
ATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAA
ATGATCTAA
[download]

Comment on Re: Print A Sequence with Start codon and different Stop Codon Select or Download Code

Replies are listed 'Best First'.
Re^2: Print A Sequence with Start codon and different Stop Codon by PerlKc (Novice) on Oct 28, 2015 at 01:44 UTC
Output is right on dot, but couldn't get it when I used the code you posted.	[reply]
Re^2: Print A Sequence with Start codon and different Stop Codon by PerlKc (Novice) on Oct 28, 2015 at 01:50 UTC
THanks Bunch, It Works. YAYYYYYYYY! I have a quick question what does the ?? before the print command does?	[reply]
Re^3: Print A Sequence with Start codon and different Stop Codon by Anonymous Monk on Oct 28, 2015 at 01:56 UTC
See "(??{ code })" in perldoc perlre	[reply]
Re^4: Print A Sequence with Start codon and different Stop Codon by Anonymous Monk on Oct 28, 2015 at 12:08 UTC
should that be "(?{ code })" instead of "(??{ code })" ?	[reply]
Re^5: Print A Sequence with Start codon and different Stop Codon by Anonymous Monk on Oct 28, 2015 at 13:42 UTC
Re^6: Print A Sequence with Start codon and different Stop Codon by Anonymous Monk on Oct 28, 2015 at 13:52 UTC
Some notes below your chosen depth have not been shown here


more useful options
	PerlMonks