Re: Replacing substrings within hash values

Perhaps this will help? (Sorry, I'm too lazy to use Bio::*):

#! perl -slw
use strict;
use Inline::Files;
use Data::Dump qw[ pp ];

my %seqs = map{ split "\n", $_ } <FASTA>; 
pp \%seqs;

while( my( $seq, $pos, $chr, $rep ) = split ' ', <EDITS> ) {
    substr( $seqs{ '>' . $seq }, $pos-1, 1, $rep );
}

pp \%seqs;

__FASTA__
>I
CATCAGTATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA
>II
TACCACAGATACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC
__EDITS__
I   2   A   G
I   4   C   T
I   5   A   G
I   7   T   C
II  1   T   C
II  2   A   G
II  3   C   T
II  5   A   C
II  8   G   T
II  10  T   G
[download]

Output:

C:\test>1158701
{
  ">I"  => "CATCAGTATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA",
  ">II" => "TACCACAGATACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC",
}

{
  ">I"  => "CGTTGGCATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA",
  ">II" => "CGTCCCATAGACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC",
}
[download]

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'

Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.

"Science is about questioning the status quo. Questioning authority". I knew I was on the right track :)

In the absence of evidence, opinion is indistinguishable from prejudice.

Comment on Re: Replacing substrings within hash values Select or Download Code

Replies are listed 'Best First'.
Re^2: Replacing substrings within hash values by K_Edw (Beadle) on Mar 24, 2016 at 11:20 UTC
Thanks! I'll have a go at understanding this. I've not come across 'map' before. It would also be good if somebody could help me understand what's wrong with my own code (for learning purposes), and also because I may wish to introduce more ways of editing such as deleting certain letters and thus needing to keep track of changes as it goes to ensure replacements still occur in the right place.	[reply]
Re^3: Replacing substrings within hash values by BillKSmith (Monsignor) on Mar 24, 2016 at 13:27 UTC
The main problem with your code is that you must read the entire IN file for each sequence. This would work if you rewind (`seek IN, 0, 0`) the IN file at the end of the sequence loop. This approach is very inefficient. Run-time would become unacceptable for larger files. Your use of `last` is fine for sequence I. For all other sequences, it would exit the loop before it gets to the processing. Use `next` instead. Bill	[reply] [d/l] [select]
Re^4: Replacing substrings within hash values by K_Edw (Beadle) on Mar 24, 2016 at 13:57 UTC
I see, thank you. The script is now working as desired after fixing the usage of substr, using next and the addition of seek(IN,0,0). Is there a more efficient way to accomplish this or is this an unavoidable consequence of the way the script is structured/written? My thought was that i'd only need to iterate over IN once as it's sorted and that once $F[0] no longer equalled the current key, it would begin reading IN where it left off for the next sequence before it terminated.	[reply]
Re^5: Replacing substrings within hash values by poj (Abbot) on Mar 24, 2016 at 14:20 UTC
Re^6: Replacing substrings within hash values by K_Edw (Beadle) on Mar 24, 2016 at 17:25 UTC
Re^6: Replacing substrings within hash values by K_Edw (Beadle) on Mar 25, 2016 at 11:16 UTC
Some notes below your chosen depth have not been shown here
Re^5: Replacing substrings within hash values by BillKSmith (Monsignor) on Mar 24, 2016 at 22:48 UTC
Re^6: Replacing substrings within hash values by BrowserUk (Patriarch) on Mar 25, 2016 at 01:57 UTC
Some notes below your chosen depth have not been shown here


Clear questions and runnable code get the best and fastest answer
	PerlMonks