DNA that is a JAPH

[theorbtwo]

Just to compliment the DNA Obfu of Ranna, here's my own first obfu, dnareader.pl:

#!/usr/bin/perl
# Run as dnareader.pl TCCCTCATTGAATCCAAACC
# You'll get a ++ from me if you can make it say "perl" 
# instead.
$"='ATCG';
foreach (split '', shift) {
 $;++;$,=$,<<2|index $",$_; 
 next if 
 $;&3;$,=print chr $,;$,--;
}

I know, the obfuscation isn't that hard, but I think it's a cool idea anyway.

Thanks,
James Mastros,
Just Another Perl Scribe

[grinder]

Nifty!

   perl dna TGAATCTTTGACTCGA

Hope I transcribed that correctly. I just hacked the following out of your code. Ugly, but does the job

#!/usr/bin/perl
# Run as dnareader.pl TCCCTCATTGAATCCAAACC
# You'll get a ++ from me if you can make it say "perl" 
# instead.

for my $g1 ( 'A', 'C', 'T', 'G' ) {
for my $g2 ( 'A', 'C', 'T', 'G' ) {
for my $g3 ( 'A', 'C', 'T', 'G' ) {
for my $g4 ( 'A', 'C', 'T', 'G' ) {
  print(  "$g1$g2$g3$g4 - " );
  letter( "$g1$g2$g3$g4" );
  print "\n";
}}}}

sub letter {
$"='ATCG';
foreach (split '', shift) {
 $;++;$,=$,<<2|index $",$_; 
 next if 
 $;&3;$,=print chr $,;$,--;
}
}

From there it's a simple matter of working backwards...

--

g r i n d e r
TACCTGTTTGAGTGTAACAATCATTCGCTCGGTGTATCCATCTTTGACACAATCACTCGGTCTCTCCA

[theorbtwo]

Hey, that's cheating; I was hoping sombody would figure out the encoding and do it the hard way... nonetheless, it's certianly valid. grinder++

Thanks,
James Mastros,
Just Another Perl Scribe

[patgas]

Yeah, but you said:

You'll get a ++ from me if you can make it say "perl"

That's "perl", not "perl\n"! :)

"We're experiencing some Godzilla-related turbulence..."

[patgas]

I think this oughta do it...

foreach $letter ( split //, shift @ARGV ) {

    @digits = ();
    $num = ord $letter;

    while ( $num ) {
        unshift @digits, $num % 4;
        $num = int $num / 4;
    }

    unshift @digits, 0 while @digits < 4;
    $base4 = join '', @digits;
    $base4 =~ tr/0123/ATCG/;
    $string .= $base4;

}

print $string;

Using this, I get 'perl' to be TGAATCTTTGACTCGA. This was fun, thanks!

"We're experiencing some Godzilla-related turbulence..."

[theorbtwo]

Cool, the elegant solution. patgas++. BTW, you both forgot the newline. <G>

Thanks,
James Mastros,
Just Another Perl Scribe

[Ranna]

Erf.. bit late, oh well. TGAATCTTTGACTCGA. I figured out how to work through the letters eventually, that speeded things up.

[o(o_o)o]

TTAATATTTTACTAGAAACC ;-)

~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
i would slit my wrists for you

[theorbtwo]

I was just looking back on this code, much, much later, and found the matching "dnawriter.pl". It's past the readme below:

Read more... (605 Bytes)