If you don't want to "slurp" in the whole file at once:
my $name;
my $seq;
while (<DATA>) {
chomp;
if (s/^Name:\s*//) {
$name= $_;
next;
}
if (s/^Nucleotide Sequence:\s*//) {
$seq= $_;
while (<DATA>) {
last if /^s*$/;
chomp;
$seq.= $_;
}
print "$name\n$seq\n\n";
}
}
__DATA__
GeneID: 1002
Name: cadherin 4, type 1, R-cadherin (retinal)
Chromo: 20
Cytoband: 20q13.3
Nucleotide Sequence: atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggc
acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagcagtacacag
cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa
GeneID: 10077
Name: tetraspanin 32
Chromo: 11
Cytoband: 11p15.5
Nucleotide Sequence: atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc
GeneID: 10078
Name: tumor suppressing subtransferable candidate 4
Chromo: 11
Cytoband: 11p15.5
Nucleotide Sequence: atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa
s$$([},&%#}/&/]+}%&{})*;#$&&s&&$^X.($'^"%]=\&(|?*{%
+.+=%;.#_}\&"^"-+%*).}%:##%}={~=~:.")&e&&s""`$''`"e
-
Are you posting in the right place? Check out Where do I post X? to know for sure.
-
Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
<code> <a> <b> <big>
<blockquote> <br /> <dd>
<dl> <dt> <em> <font>
<h1> <h2> <h3> <h4>
<h5> <h6> <hr /> <i>
<li> <nbsp> <ol> <p>
<small> <strike> <strong>
<sub> <sup> <table>
<td> <th> <tr> <tt>
<u> <ul>
-
Snippets of code should be wrapped in
<code> tags not
<pre> tags. In fact, <pre>
tags should generally be avoided. If they must
be used, extreme care should be
taken to ensure that their contents do not
have long lines (<70 chars), in order to prevent
horizontal scrolling (and possible janitor
intervention).
-
Want more info? How to link
or How to display code and escape characters
are good places to start.
|