Re: non-exact regexp matches

in reply to Re^2: non-exact regexp matches
in thread non-exact regexp matches

Will this do?

    use re 'eval';
    no strict 'refs';
    if (/(A)?(C)?(C)?(A)?(A)?(C)?([ACGTacgtNn]{6})?(CTA[ACGTacgtNn]{1}
+)?
         (A)?(T)?(G)?([ACGTacgtNn]{1,2})?(G)?(A)?(T)?(G)?(T)?(T)?
         (?(?{17 <= grep {defined $$_} 1 .. 19})|(?!))/x) {
        ...
    }
[download]

Abigail

Comment on Re: non-exact regexp matches Download Code
Re^2: non-exact regexp matches by Anonymous Monk on Jun 25, 2004 at 15:14 UTC
Hi, I tested your program on the following sequence: `ACCAACCGGATTCTAGATGCAGATGTTGAAGATT # works OK. Change the second C for a G: AGCAACCGGATTCTAGATGCAGATGTTGAAGATT # Doesn't work.` [download] I'm looking over your regexp... bu it'll take me a while to figure it out. Thanks for the help. Vince	[reply] [d/l]
Re^3: non-exact regexp matches by japhy (Canon) on Jun 25, 2004 at 15:22 UTC
That's because Abigail-II's regex only handles the case of deletions. To support insertions and modifications, you need a more robust approach. _____________________________________________________ Jeff`[japhy]`Pinyan: Perl, regex, and perl hacker, who'd like a job (NYC-area) `s++=END;++y(;-P)}y js++=;shajsj<++y(p-q)}?print:??;`	[reply]
Re^4: non-exact regexp matches by vinforget (Beadle) on Jun 25, 2004 at 16:37 UTC
Thanks Jeff. I think I read up some more on advanced regexp before i get in over my head. Vince	[reply]


Perl: the Markov chain saw
	PerlMonks

Re: non-exact regexp matches

How many continents have you visited?