Beefy Boxes and Bandwidth Generously Provided by pair Networks Cowboy Neal with Hat
XP is just a number
 
PerlMonks  

Would you work at a porn company?

by jacques (Priest)
on Feb 12, 2005 at 03:17 UTC ( #430359=perlmeditation: print w/ replies, xml ) Need Help??

Recently an online porn company contacted me for a Perl job. I am currently looking for work, but I politely declined, citing my uncomfortableness with the adult content. The money was good and the location was nice: South Beach in Miami.

I am curious about geeks working in porn. Porn seems like a big, steady business. But I wonder about the repercussions of listing a porn company on a resume:

Would you face discrimination from future employers?
Would other geeks look down at you?
Would your former stint at a porn company hinder you from finding work in a foreign land? (China, for example, imprisons porn website operators.)

And what's it like at a porn company? Are the programmers exposed to the porn?

Would you have considered taking the programming job? Why or why not?

Comment on Would you work at a porn company?
Re: Would you work at a porn company?
by Elgon (Curate) on Feb 12, 2005 at 04:00 UTC
    Very interesting question Jacques,

    During a period of enforced idleness, I applied for a job at a company which has both porn and non-porn arms as a junior programmer for a short period. As it turned out, I didn't get the job so it became a moot point.

    The bottom line is that you must make two judgements IMHO; Firstly, can you reconcile working for a company which sells pornography and may, potentially, be involved in the creation and dissemination of malware with your personal principles? Secondly, do you think that it will prejudice future job applications? I think that this very much depends on the personality and beliefs of the person interviewing you for the next job, however I believe that it will follow you and may possibly have adverse effects on future applications.

    You have already asked these questions, however I cannot give you any real answers to either of them, only share my own opinions.

    On a personal level, I know the IT director of the aforesaid company and he assured me that they do not produce malware. I believe him. They also deal in adult material, involving only adults above the age of consent and require proof of age. I do not see this as a great evil, personally, however many will.

    Good luck, whatever you may decide.

    Elgon UPDATE: As per Jacques' post below, he's already turned the job down. This is what you get for skim reading with a beer in one paw. To be honest, I'd had a few beers and just kinda zeroed in on the word "porn".

    It is better either to be silent, or to say things of more value than silence. Sooner throw a pearl at hazard than an idle or useless word; and do not say a little in many words, but a great deal in a few.

    Pythagoras (582 BC - 507 BC)

      Good luck, whatever you may decide.

      I already decided to turn them down, as I point out in the post. I am curious about the opinions of others and what the ramifications are for those geeks who decided to work in that industry.

Re: Would you work at a porn company?
by Fletch (Chancellor) on Feb 12, 2005 at 04:32 UTC

    Will there be repercussions? Probably it'll colour some prospective employers' against you (same as if you worked for a spammer; though some people might even consider that much worse :), others may not care one whit. The same with other geeks: some are probably going to look down their nose at you, others may think you've got the coolest job in the world (I can certainly think of some former coworkers that'd fall into the latter category).

    As for the working in other countries, only place I could think you could even start looking for an answer to that would be possibly talking to a lawyer specializing in immigration and the like. Or if you've got a specific country in mind try contacting their closest embassy or consulate.

    And lastly as for being exposed to the porn, one would think they'd sell that as a fringe benefit (fringe . . . or lace . . . maybe feathers . . . sorry, where was I? :). Would make bringing extra work home with you more attractive.

    Would I have considered taking it, probably no. Then again I'm married with young kids. But if it was a choice between slinging pr0n and slinging burgers at Mickey D's, it'd start to look better and better.

      Will there be repercussions? Probably it'll colour some prospective employers' against you

      I have been in interviews where the interviewer would put down porn companies, so I see it as a negative repercussion.

Re: Would you work at a porn company?
by grinder (Bishop) on Feb 12, 2005 at 08:29 UTC

    In the absolute, yes, I would have considered taking the job. I have mortgage payments to meet on my home, and my children to feed. If there was nothing else going (becasuse driving a taxi just wouldn't make ends meet) then yes, I would take the job.

    That said, I'd lie about it afterwards on my résumé. I'd probably say I worked for a multimedia agency or something like that.

    Putting it in a different context, if the choice was between a porn operation and a spamhaus, I'd take the porn operation any day.

    I once watched a TV interview of a French porn star, Estelle Desanges. She entered the business knowing full well what the realities were. She enjoys the work and gets to decide what she does and what she chooses not to do.

    There's porn and there's porn. Photographs of nude women can be very erotic and the body-as-sculpture school of thought leads to some very stunning images. Then there's porn where the women are obviously unhappy junkies and they're only doing it to earn enough money to pay for herion or whatever. That's just ugly, ugly, ugly (not the women, the situation). If I was forced to work for a porn operation, I would hope it was the former type. If it was the latter, I'd get out of there fast, try and negotiate with my bank about the mortgage.

    But there's no good spam. I think spammers hold a far greater responsability for the rise of malware and trojans. They are the main reason that at work I now firewall off all residential IP blocks that I learn of on my mail server. Spammers are ruining the Internet, I don't think the pornographers are.

    In any event, touch wood, I sincerely wish I never have to make the choice.

    - another intruder with the mooring in the heart of the Perl

      Arguably, Pronographers *made* the internet what it is today...
Re: Would you work at a porn company?
by drfrog (Deacon) on Feb 12, 2005 at 09:00 UTC
    While ive never worked for a porn company, i've worked for other morally objective companies; marketing firms!

    what would be worse, programming porn, pharmacuticals or firearms?
    :)

    I really wouldnt have a problem with it, but im very open minded.
      programming spam (or politics)

      MJD says "you can't just make shit up and expect the computer to know what you mean, retardo!"
      I run a Win32 PPM repository for perl 5.6.x and 5.8.x -- I take requests (README).
      ** The third rule of perl club is a statement of fact: pod is sexy.

        Looking at the entire thread as a whole, I think this is the best spot to insert my comments/summary.

        I think the answer each person has given has been basically been how that person views porn (as an industry, not a product ;-}). Which doesn't always answer the first few questions - everyone has concentrated on the last questions: would you take the job, and why/why not? IMO, these are the most important questions, but I will get back to the others.

        So, the answer to these questions is really a matter of principles and priorities. (If your principles are not a priority, then they play into the question much less than, say, putting food on your kids' plates, putting a roof over their heads... or maybe even less than putting a big-screen TV in your living room. You choose your priorities.) In your own view, is pornography an issue of principles? It is (currently) legal - is that just? (If it were illegal, same question would apply, although now you'd have to ask if it was worth the money and risk.)

        As to the first questions, which is how would future employers look at it, in small companies management can afford to be more biased about these types of experiences. Larger companies generally will (in my experience) follow how society treats the topic. Which is quite schizophrenic from where I sit. Here we have a topic which is disagreeable to both the Feminists, and the Religious Right (probably nearly the only thing these two extremes agree on), and yet it's still legal. So it probably won't really negatively affect your chances for a job elsewhere.

        Thus, if you don't have a personal problem with the porn industry, then why not take the job?

        Personally, I find the whole industry to be a huge negative on society, and thus would not entertain any interaction with them (job, interview, or even communicating my resume). On the other hand, I would have no issues helping out (whether paid or not - although that may depend on my financial position at the time) a political cause I believe in. (As long as they're not using immoral or even underhanded means to operate - e.g., mailing list good, indiscriminate spam bad.) Or even the political wheel in general (I was approached by the Returning Officer for my constituency for possible interest in doing IT for the next election - no problem there, although I wasn't interested in the position for completely different reasons).

Re: Would you work at a porn company?
by Ytrew (Pilgrim) on Feb 12, 2005 at 09:51 UTC
    *sigh* How does this question even remotely apply to the practice of Perl programming?

    The same questions that you pose would apply if you contracted for any other job in any other industry. Porn is no different.

    "If I work for company X which does job Y, will people who disapprove of Y disapprove of me? Will their competitors hate me? Will it hurt my job prospects? Will people still like me, if company Y is unpopular? What will my resume look like?!!!"

    The answer to all these questions is usually: "it depends on who you ask". As for how you predict those viewpoints in advance in such a way as to maximize employability and personal profit, this is a problem in socio-economics, not programming.

    It's a great way to start a flame war, though. *sigh*

    Goodwin! In advance! To everyone! Just in case! :-( --
    Ytrew *sigh*

Re: Would you work at a porn company?
by Phaysis (Pilgrim) on Feb 12, 2005 at 09:52 UTC
    The bulk of my tech work was as a junior Perl developer under contract to a company which handled the billing and link tracking for "membership-based websites", i.e. porn. This company doesn't produce the content; they merely handle the monetary infrastructure.

    That being said, I knew what I was getting into when I accepted the contract, and as time went on, I got accustomed to the openness of the Business in the business place. Whenever a site operator signed up for our services, it was our job, as our company's minions, to log into the operator's server and place our scripting and member management tools and test them before our workaday was done. This, of course, exposed us to the content on the sites. I accepted this as a fringe benefit to the job, and as time went on it became par for the course, a string of "Meh, ok." situations.

    Whenever notes have been compared, my geek friends really didn't look down upon me but thought my job was rather cool if only for that fringe benefit. As well, I've met a few fellow geeks who have done similar jobs, some even working for the content providers. But I have not come across many that would have a distaste for my old contract job (at least among web programmers and the junior Code Monkeys of the World).

    As for my future, and my resume, my job there was a contract. I am conveniently shielded from inspection by the Major Name Contracting Company through which I found this position, and by the genericness of the language with which I can define the job tasks: "managing tools and code for membership-based websites." So, in my particular case, I had little difficulty with the job at hand, and my luck landing future programming gigs will actually be enhanced by the fact that I had the job in the first place. The job is a job. Business is business.

    So if this business is a reputable one (there are porn companies of good repute, believe it or not), and if their CTO seems to be on the up-and-up, and if your modesty will allow you to handle the Business in mixed company (and if the job is still open), I say go with it. The standard caveats apply; the porn only adds a thin layer of complexity. And, as usual, your mileage may vary.

    Cheers!

    (Ph) Phaysis (Shawn)
    If idle hands are the tools of the devil, are idol tools the hands of god?

Re: Would you work at a porn company?
by zentara (Archbishop) on Feb 12, 2005 at 13:39 UTC
    There was a news segment recently on one of the national TV networks about the cable companies who are making "big money" with "porn on demand"; while at the same time being helped and sponsored by "right wing government" bureaucrats.

    Face it, America is 2-faced about sex...they decry it in public, but behind close doors.....ooh la la. Maybe it's part of the "it's more fun if it's dirty and wrong " conciousness.

    I like to meditate sometimes on "what kind of world would it be if there was no sex". From that perspective, the wild views people have about sexual morality looks insane. I say legalize it all, and people will lose their fascination with it.

    So I would say, do what the cable companies do....work with the porn industry and make your money, and when people ask you about it, tell them how you detest it. :-)


    I'm not really a human, but I play one on earth. flash japh
      they decry it in public, but behind close doors.....ooh la la

      Well said! I learned that the same had happended during the Victorian times in England.

      Besides, if the site doesn't do spanking, it should be the same as working in any other shamefully accepted job by our actual society:

      • * I saw America's Scientists page defending Reagan's world's armament theory as an argument to destroy poor countries.
      • * Big software companies talking evil ideas about OpenSource and Free OSs.
      • * Great media companies like Forbes, implanting dangerous spyware in every visitor's browser.

      I won't justify our evil instincs, but I know that I am having to live with all these for my lifetime. Because everybody is making profit on the suffering of others or on the results of foolish restrictive laws...

        Because everybody is making profit on the suffering of others or on the results of foolish restrictive laws...

        That's the reason. If you make something "illegal( or immoral)" then you can make enormous profits off of it. If you really want to stop people from wanting porn, just flood them with images of "real" naked people. There is nothing like a nudist colony to "turn you off". :-) But they are selling an "illusory image" in the porn world, of beautiful,lean, airbrushed bodies, which you would never see in reality. But in order for that illusion to be effective, it has to be made shameful, so no one publicly talks about it, and keeps it locked up in their own private fantasies. It's the perfect situation for "mind control"...and just look how it is used. Show a beer commercial to guys, with a couple of topless buleimic women in it, and you have instant "customer gratification". Now this wouldn't happen, if the men were flooded with actual images of real topless women, of all ages. And of course, it goes the other way, the average skinny legged, pot-bellied man is not your typical woman's fantasy.

        This society is going to have a hard time breaking out of this cycle, because the women know that they control men only by sex, so even though they espouse feminist ideals, they still use make up and wear suggestive clothing. The whole marriage game is based on this.


        I'm not really a human, but I play one on earth. flash japh
Re: Would you work at a porn company?
by fauria (Deacon) on Feb 12, 2005 at 15:13 UTC
    Under my point of view, it depends on what kind of 'porn' company offers. I understand that, if they are hiring people in a formal way, it is a completely legal company that pays taxes, respects rights of people involved, etc.

    If thats the case i would have accepted the job.

    There may be adult content companies that operate in the shadows, using legal rushes, and this may cause people to be cautius before acceping a job in this sector.

    But think about it: Well known multinationals exploits children in poor countries, contaminates nature, false contability, and almost no one would reject a job in one of this companies.
    Why? Because their products seems to be morally acceptable in our society.

    I have developed programs with Perl for one of the biggest pharmaceutical companies.
    Every day you see people dying in places that no one gives a sight but non profit organizations.
    To give you an example, there is an illness that causes blindness for the rest of your life that affects children. Using a first world medicine, that costs $30, this can be healed. 95% of those children remains blind, in part because that prodcut cannot be produced without infringing medical patents.

    Im not pointing those companies as the direct cause of this. What im saying is that i would personally find myself doing a job more acceptable morally, by programming for an adult entertainment company that usually makes people happy in some way.

    I of course respect your decision, that is just my oppinion.
      Im not pointing those companies as the direct cause of this.
      Well, I do.

      holli, /regexed monk/

      Waitasecond. Does it cost $30 just to produce the needed dose of medicine or does the quoted price include the price of the research and medical testing? Let's see ... how much does it cost to produce a CD full of software? The CD is cheap, the work needed to burn it minimal, why the heck can't we go and forget all about this stupid copyrights and all this nonsense. Sorry Fauria, infriging medical patents is just like pirating software. Someone invested money and effort, are you gonna steal it?

      We may try as we can, pump money, food and medicine into these parts, but until they learn to make only as many kids as THEY can feed, as long as they keep fighting their neighbours just because they come from a different tribe, as long as they keep blaming us instead of doing something to change their own countries, all the help will only increase the problems. The more children we save, the more children we have to feed and the even more children get born. Call me whatever you wish, but the only aid I'm wiling to back up is condoms.

      Jenda

        I find your comment seriously offensive.

        However, i will make an effort satisfying your request, and i will call you what i wish:

        Heartless.
        ... infriging medical patents is just like pirating software. Someone invested money and effort, are you gonna steal it?

        Bullshit.

        Neither copyright nor patent violation involves "stealing" someone's money and effort.

        If you violated the patent and made a dose of the medicine to keep a child from going blind, the accountants at the drug company don't come in the next day and find that their safe has been busted open and their stack of cash is gone.

        So-called "intellectual property rights" are not natural (or "God-given") human rights; they are instead granted by a society, because we believe that it helps to align profit motive with the overall societal interest. (For example, the US Constitution puts it this way: "To promote the Progress of Science and useful Arts, by securing for limited Times to Authors and Inventors the exclusive Right to their respective Writings and Discoveries".)

        Those commercial interests must be balanced against the fundamental human and societal interests which they are supposed to serve.

        Feel free to get on your high horse to denounce teenagers for downloading cracked copies of Duke Nukem -- but if you are going to talk about little children going blind, you ought to balance that ideology with some humanity.

        We may try as we can, pump money, food and medicine into these parts, but ...

        Again, bullshit.

        This isn't a question of "us" "pumping money" into "those parts" -- it's a question of large corporations sucking money out.

        The actual production of most pharmaceuticals can be carried out in the "developing" world; for example India has a bunch of manufacturing plants that can make generic versions of almost anything, and I'm sure they're not alone.

        The question is one of licensing payments, pumping money *out* of the poor countries and into the richer ones.

        If local governements or intertnational aid workers are trying to treat a disease, and in addition to the $30 for manufacturing they also have to pay $30 to the American company that owns the patent, they're only going to be able to buy half as many doses, and that means little children will be permanently blind.

        ... until they learn to make only as many kids as THEY can feed ... all the help will only increase the problems. The more children we save, the more children we have to feed and the even more children get born.

        Wait a second -- we're talking about a medicine that keeps children from going blind.

        Presumably, being blind is going to make it much harder for those children to grow up to be self-sufficient and take care of their own problems, right? People blinded since childhood are more likely to be dependent on aid, as opposed to someone with sight who can try to farm or get a job, right?

        So what's the upside of having the children go blind?

        Are you hoping that once they're blinded, they're more likely to die, so you won't have to send them food aid anymore?

        Or that maybe if they're blind they'll be less able to find a partner and have children of their own? It seems like a small step from that position to deliberate infection, forced sterilization, and other totally inhumane treatment.

        Do you want to walk that one back a little?

        -Simon

        Have to call bullshit as well. Besides the fact that a good deal of developed drugs in the US are primarily developed with tax payer money, the fact is pharmacuticals have way too much power in the US. Yes, they deserve to make money, but seeing it is indeed a matter of life and death for almost every human at some point in their existance, they should not operate under the same freedoms as say, a record label.

        Take HDL, most doctors would agree that making synthetic HDL would help the majority of people with heart disease, a top killer. Yet it was never made.

        Why? It's easy enough to make, the fact is there is no money in it. Well actually, there is, but not the goddamn ludicrous margins they want.

        Result? Millions die. So they find a family in Italy that has HDL that is a little better than average, but more importantly, the mutation allows it to be patented. Right to market. It's bullshit. I'm willing to bet that almost everyone here knows someone who had a heart attack. Where's the outrage?

        I realize the drug companies are private, if they don't want to spend there money, fine. Why doesn't the goverment? It could save them untold millions (billions?) not to mention lives. The reason is conflict of interest.

        This is but one of many examples.

        -Lee
        "To be civilized is to deny one's nature."
Re: Would you work at a porn company?
by cog (Parson) on Feb 12, 2005 at 15:50 UTC
    Just two weeks ago I was working with a client; we were giving Bricolage training to them and we got the time to share some experiences.

    While talking about organization, the leader of their team told us he once went to the place where a Portuguese porn magazine was made. He said it was just like doing any other magazine: the people would act the same, the people would dress the same, the people would work the same.

    He said if you didn't look at the pictures it would look just like any other magazine. There were actually people writing the stories as if it was something else.

    Come to think of it, it's a business just like any other else... morally questionable? Well, that's up to you. I don't think that by taking such a job you'd be exposed to porn. It's not like they're going to shoot the movies in front of you, right?

      "Morning, miss. I've come to fix your Perl script."

      Nah. It'd never sell :)

        ROTFL,
        Geek Porn™, you might be on to something. The sysadmin and the comely secretary, think of all the bad fsck innuendos

        -Lee
        "To be civilized is to deny one's nature."
Re: Would you work at a porn company?
by TomDLux (Vicar) on Feb 12, 2005 at 18:20 UTC

    It was working at a porn company that caused me to add Perl to my languages list. I did work on their non-porn sites, too, which are the ones I mention during interviews.

    Most of the time it wasn't particularly different from working on other web-site assignments.

    On the other hand, if you alter the client-side javascript or the server-side code for some page, you have to verify it works right. I enjoy pointing out that most companies fire employees found with porn on their screen. At the porn company, it means you're doing your job; you get fired if you NEVER have porn on your screen.

    --
    TTTATCGGTCGTTATATAGATGTTTGCA

Re: Would you work at a porn company?
by dragonchild (Archbishop) on Feb 12, 2005 at 20:35 UTC
    I have done some small contracting work for one. My big question was "Do you do child, animal, or non-consensual porn?". While I never actually saw the actual media, it was important to me that nothing repugnant to me, personally, was being supported with my work.

    Frankly, I have almost never understood the applications I work on. Heck, I don't even understand the applications I have designed from scratch! I'm a builder, not a user.

    Here's another way to look at the topic - porn is serving multimedia in a rapid fashion. My first Perl job was doing exactly that, but for images of corn, tractors, and bees. What's the difference?

    My last job was to automate submission and indexing of multimedia from various sources and to improve the response time for searches and delivery of said multimedia.

    Porn? Corn? Can you tell the difference?

    Being right, does not endow the right to be rude; politeness costs nothing.
    Being unknowing, is not the same as being stupid.
    Expressing a contrary opinion, whether to the individual or the group, is more often a sign of deeper thought than of cantankerous belligerence.
    Do not mistake your goals as the only goals; your opinion as the only opinion; your confidence as correctness. Saying you know better is not the same as explaining you know better.

Re: Would you work at a porn company?
by samtregar (Abbot) on Feb 13, 2005 at 00:54 UTC
    Where I work a sys-admin is leaving to take a job with a large porn outfit. They're doing a major architectural revision and he'll be working on the network and setting up servers. As far as I could tell no one looked down on him for his decision. There were a lot of jokes about getting free passwords though...

    Personally, I don't think I could do it, if only for my mother's sake. She's an old-school feminist and I don't think she'd understand.

    -sam

Re: Would you work at a porn company?
by sfink (Deacon) on Feb 13, 2005 at 06:26 UTC
    I'd take it in a second. When I'm lying on my deathbed, I'd much rather be able to think back on a whole bunch of bizarre and varied jobs, than to think "I spent my entire life working at XYZ."

    Besides, I'd love to be able to watch the look on my grandkids' faces when I told them about my career history. Those smugly satisfied, oh-so-worldly little brats. (In the interest of full disclosure, I should probably mention that I neither have nor expect kids yet.)

Re: Would you work at a porn company?
by bageler (Hermit) on Feb 13, 2005 at 17:25 UTC
    I worked at a porn company for 5 years. Pay was great, and all the software I wrote was unique, i.e. I was doing things for the first time every time I wrote something. I was exposed to porn regularly, since I was in charge of the content management system and cc processing, and since it is by definition a scandalous industry, there is a lot of scandal and impropriety in the industry. I developed moral problems with the company, and that is why I left. It was no longer setting me at ease to know that I'm creating cool technology, the attitudes of the industry really started to bother me. Oh, and how did I describe my job to my grandparents? "I work in internet marketing and credit card processing. I am in charge of a high volume media distribution website."
Re: Would you work at a porn company?
by cowboy (Friar) on Feb 14, 2005 at 01:03 UTC
    I've worked in the past, and currently work, in a company that serves porn up to paying members.

    I've never encountered any discrimination from other employers, in fact, most seemed to think something like 'Great, he knows how to build stuff that handles high-volume'.

    As for being exposed to porn, at least in the positions I've held, there wasn't alot of it. (no more than your average web-surfing trip would bring you in popups/ect)

    I mean, sure, there are gigs and gigs of it on the content servers, that I could go digging through if I wanted, but it's not there in front of me all day, most of the time I see a text editor.
      'Great, he knows how to build stuff that handles high-volume'.

      lol

Re: Would you work at a porn company?
by dimar (Curate) on Feb 14, 2005 at 01:41 UTC
    Would you have considered taking the programming job? Why or why not?

    Interesting question, both on its face, and in the way you asked it. Let's try a quick sketch of the issues:

    • Legality (always relevant regardless of industry, some 'reputable' firms have malfeasance too)
    • Stigma based on the "sleaze factor" (what will my family think)
    • Stigma based on peers (what do other techies think)
    • Personal / Professional development (what's it really like there?)

    You could lay out the issues and be deliberate and calculating (e.g., Legality is not a problem as long as the firm 'appears' reputable .. in which case you wouldn't work in 'porn' but you would go to work for a company like Enron .. for example). In the final analysis, it's probably a question of your own personal ultimate values (aka no one can really answer it for you) (except perhaps, "what is it like working there") but even that varies depending on the specific people/culture at the location you will be working. Even within a single company it varies.

    Bottom line: it's probably not good to automatically stigmatize someone based on their industry, just like its probably not good to discriminate against someone based on what neighborhood they live in. It's easy to turn your nose up at the "porn" and yet how many of us have "prostituted" our intellect, abilities, time and values to 'fit in' elsewhere? Does it change the propriety just because it is "illegal" in some places and not in others?

    Best wishes to you in your employment endeavors, *and* in your moral and ethical status as well.

      Bottom line: it's probably not good to automatically stigmatize someone based on their industry

      My post doesn't stigmatize anyone.

      It's easy to turn your nose up at the "porn" and yet how many of us have "prostituted" our intellect, abilities, time and values to 'fit in' elsewhere?

      So what are you saying? That we should accept porn because we are all prostitutes?

        My post doesn't stigmatize anyone.

        I noticed that. I was referring to the prospective employers of the world, those who might be reading this, those who might be inclined to devalue a prospective employee, not you or your post.

        So what are you saying? That we should accept porn because we are all prostitutes?

        Non sequitir. It was a rhetorical question. Let every man woman accept or reject whatever according to their own understanding and judgement. Whoever can say "my hands are totally clean" ... good for them.

Re: Would you work at a porn company?
by Anonymous Monk on Feb 14, 2005 at 10:50 UTC
    1. Would you face discrimination from future employers?

      Doubtful. I've had quite some jobs, and hence, I've been hired a lot of times. Future employers tend to be far more interested in what you did than who happened to named on your pay cheque.

    2. Would other geeks look down at you?

      Oh, most certainly there will be geeks looking down on you. There will also be geeks that'll adore you and who want to have your job.

  • Would your former stint at a porn company hinder you from finding work in a foreign land? (China, for example, imprisons porn website operators.)

    No idea. But if former stints where something to worry about, I'd be more afraid of the USA than of China.

  • And what's it like at a porn company? Are the programmers exposed to the porn?

    That would probably depend on the job you're doing. If the job is "make websites" or "process images", then, yeah, I presume you are "exposed" to porn. But if your job involves keeping servers happy or to write payroll software, there's no reason you will be "exposed" to porn. But it may.

    I've worked for banks, I've worked for financial software companies, I've worked in the health care industry, I've done gigs for the NATO, revenue services, and for telco's. I haven't been exposed (at work) to money, pills, doctors, planes, tax forms, or phones. I've once used (outdated) occurances of certain diseases of a state broken down by zip-code though. But that's about all the non-hardware, non-software "exposure" I've got.

  • Would you have considered taking the programming job? Why or why not?

    Too little information. It would depend on the work I'm supposed to do, the compensation, work hours, office location, how badly I need a job, future co-workers, my impression of the company, the companies stability record, and more. I've no moral objection against porn.

Re: Would you work at a porn company? (OT: Dialogs in porn)
by holli (Monsignor) on Feb 14, 2005 at 11:01 UTC
    Most porn dialogs are plain stupid. see this (worksafe!) video.

    I am as sorry as possible that it is in german language.


    holli, /regexed monk/
Re: Would you work at a porn company?
by bwelch (Curate) on Feb 14, 2005 at 15:36 UTC
    Some interesting situations could be created.

    On a date, when you are asked what you do, how would you respond? Describing a developer job isn't hard, but when they ask you what your company does how do you respond? If you answered in a deceptive manner, would you later feel bad about it? Would you openly describe the company and see if the date ends rather quickly.

    If you are married with or without kids, it could get more interesting. Would your wife / husband / kids lose respect for you because of your job?

    In jobs of my past, the culture and attitudes of the company ended up affecting my own attitudes and personality, albeit sometimes in minor ways. Worrying at a porn company, I'd worry about the same thing happening, possibly in ways I couldn't anticipate.

      If you work for a gun factory, do you tell your friends? Even if you keep its databases up and running? To friends that don't know anything about computers? If you keep the servers running for a tobacco company, what do you say to your kids when you don't want them to smoke? If you work for Microsoft, would you admit it? Would your wife lose respect? If you work for a pharmaceutical company, do you tell your date? Do you still tell your date after she told you her kid sister is handicapped because of some side-effects of some medication her mother took while pregnant of the sister? Do you tell if you work for the car industry? The oil industry? Venture capitalists? Do you tell that you worked for Enron? McDonalds? Amazon? SCO? A logging company? The CIA?

      If you shy away from working in the porn industry because of its tainted name, where else would you not work? And if that's a rather short list, wouldn't that be hypocrite? Did I write a sentence that wasn't a question?

        Did I write a sentence that wasn't a question?

        Do we really have to answer that?

      i don't mind
Re: Would you work at a porn company?
by merlyn (Sage) on Feb 15, 2005 at 06:00 UTC
      Playboy is no porn. Ever seen genitals in a Playboy?


      holli, /regexed monk/
        Yes I have actually, several times. For one, in Asia Carrera's "Blue Moon"; there is a scene that lasts for .. uhm, lets say a full minute where a mans genitals is fully displayed. Not to mention that the word "genitals" include the female genitals as well.. so.. uhm.. yea i have seen my share of genitals in playboy.
Re: Would you work at a porn company?
by inman (Curate) on Feb 15, 2005 at 09:05 UTC
    I am guessing that the company is listed on the stock exchange as 'Girls with big Bazonkas corp.' but has a rather more mudane corporate title. I suggest that when you write your résumé you use the plain name.

    It's also worth pointing out that there are varying degrees of pornography. Playboy, for example, is unlikely to spark much controversy. An on-line publication featuring borderline illegal hardcore is less likely to get by on a CV.

    At the end of the day any job pays the bills and you may end up with some valuable experience that you can use in other jobs further down the line.

      Playboy, for example, is unlikely to spark much controversy.
      At least not in civilized countries. But in the USA, even "Cosmopolitan" has the front-text covered by some super markets because it may contain words that will damage the soul of the children. Playboy isn't sold at such super market. And I'm not talking about a small community in the bible belt - but big city east coast USA. But what do you expect from a country that has had a "nipple gate"?

      Of course, the newsstand two blocks futher has an impressive collection of porn magazines.

      I don't mind porn. It's teddy bears where I draw the line.

        The stores I shop at put a board over the covers of any magazines that have scantily clad women (and men? doesn't seem to be a regular occurrence in practice.) So some issues are obscured and some are not.
Re: Would you work at a porn company?
by Booger (Pilgrim) on Aug 22, 2006 at 20:59 UTC
    I realize it's a been a long time since the original node was created but I thought I'd add my two cents.

    jacques, props to you for not taking the job.

    The Western world is too quick to label it "just another job." We have adopted a philosophy that suggests all which is permissible is acceptable. We are fools for thinking so: everything is permissible for me but not everything is beneficial (NIV).

    A porn addiction, like so many other addictions, is a brutal thing. The brief, selfish satisfaction it brings is a cancer to the people who have become slaves to it. Everything in this world has positive and negative. It's a pity that we are so blind to the negative aspects of our choices.

Re: Would you work at a porn company?
by Fengor (Monk) on Dec 01, 2006 at 11:32 UTC
    Yes i'd taken the job providing the basic requirements are met: job is not illegal where i work, pay is able to pay my bills, and so on. I wouldn't even have second thoughts about it,but that may just be me since i dont have much problems with the human body and the likes of people as long as they dont force those likes on me. So if they want to see porn flicks i would as readily work as a programmer for that company as if their customers would like cooking learning videos to become new kitchen chefs.

    --
    "WHAT CAN THE HARVEST HOPE FOR IF NOT THE CARE OF THE REAPER MAN"
    -- Terry Pratchett, "Reaper Man"

Reaped: Re: Would you work at a porn company?
by NodeReaper (Curate) on Apr 26, 2008 at 00:12 UTC
Reaped: Re: Would you work at a porn company?
by NodeReaper (Curate) on Feb 22, 2010 at 00:04 UTC
Re: Would you work at a porn company?
by Anonymous Monk on Nov 14, 2010 at 19:59 UTC
    sure, since I'm a retired guy and no worry about exposure. Also, not in need of any pay. Heard porn don't need fluffers anymore.?? That's too bad but nothing like that around N.J. so not likely anyone would make an offer
Re: Would you work at a porn company?
by JavaFan (Canon) on Nov 14, 2010 at 22:47 UTC
    I would not turn down the job because of content. But I wouldn't take the job if I wasn't sure if they weren't "ethical". The porn industry has a dubious reputation. I would have to be sure they wouldn't be involved in spamming, malware, nasty javascript, annoying popups, etc, etc. And on the non-technical aspect, I would to be made sure they aren't involved in anyway in forcing models to do what they do not want to do. I have turned down jobs because of that reason (not from the porn industry, but from the industry that's pushing ringtones and expensive SMS-based games)

    But I would not balk at the content.

    Besides, I've worked for banks. That got to be worse than porn.

      Besides, I've worked for banks. That got to be worse than porn.

      Thats a hair away from working for Hitler

Re: Would you work at a porn company?
by pemungkah (Priest) on Nov 16, 2010 at 03:29 UTC
    I would note that working for a certain company that used to do search and which has multinational offices required me to spend a week searching for porn to test the filters necessary for each country (were the right things allowed? were the right things blocked?).

    It becomes amazingly boring really fast.

    Possibly the weirdest work-week ever. I posted a "SURFING PORN FOR TESTING - DON'T LOOK AT MY SCREEN IF THIS BOTHERS YOU" sign outside my cubicle, because there's this grey area - I'm required to surf porn for my job, but I'm also required to avoid things of a sexual nature that might be disturbing to other employees. The sign was the best compromise I could come up with, short of trying to book a conference room for two weeks solid. And I would have been uncomfortable surfing porn in a locked conference room for a week...

Re: Would you work at a porn company?
by mojotoad (Monsignor) on Nov 17, 2010 at 08:54 UTC
    Yet another gem for the Perl necklace, I'd say.

    (had to be thought, if not said)

Reaped: Re: Would you work at a porn company?
by NodeReaper (Curate) on Aug 20, 2011 at 19:45 UTC
Re: Would you work at a porn company?
by Anonymous Monk on May 25, 2012 at 15:47 UTC
    yes i want
Reaped: Re: Would you work at a porn company?
by NodeReaper (Curate) on Mar 21, 2013 at 01:40 UTC
Reaped: Re: Would you work at a porn company?
by NodeReaper (Curate) on Mar 30, 2013 at 01:43 UTC

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: perlmeditation [id://430359]
Approved by Elgon
Front-paged by Fletch
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others pondering the Monastery: (8)
As of 2013-05-25 15:16 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    The best material for plates (tableware) is:









    Results (520 votes), past polls