Beefy Boxes and Bandwidth Generously Provided by pair Networks
The stupid question is the question not asked
 
PerlMonks  

Re: What one-liners do people actually use?

by l3v3l (Monk)
on Dec 08, 2005 at 23:20 UTC ( #515414=note: print w/ replies, xml ) Need Help??


in reply to What one-liners do people actually use?

here is a liner I use to find reverse complementary / palindromic D|RNA sequences (thought this would be up your alley because of your sig.) :

perl -nle 'tr/A-Z/a-z/;$m=length();reverse(substr($_,($m/2)+($m%2))) e +q substr($_,0,$m/2) ? print : next' /file/of/sequences/one_per_line
works on any list of "words" tho ... /usr/share/dict/words, etc.

update: ... this node_id has 2X \d{3} palindromes and my username is a palindrome ...


Comment on Re: What one-liners do people actually use?
Download Code
Re^2: What one-liners do people actually use?
by l3v3l (Monk) on Dec 12, 2005 at 18:26 UTC
    and here is another I put together to show me :

    (line|entry) #, org.string, st. position of pal., length of pal., palindrome found

    perl -nle 'tr/a-z/A-Z/;$l=length();for $m(3..$l){for $c(0..($l-3)){las +t if $m+$c>$l;$f=substr($_,$c,$m);($r=reverse($f))=~s/s+//g;print "$. +\t$_\t$c\t$m\t$f" if ($f eq $r);}}' example | more
    so for your sig : "TTTATCGGTCGTTATATAGATGTTTGCA" I get the following output:
    1 TTTATCGGTCGTTATATAGATGTTTGCA 0 3 TTT 1 TTTATCGGTCGTTATATAGATGTTTGCA 2 3 TAT 1 TTTATCGGTCGTTATATAGATGTTTGCA 12 3 TAT 1 TTTATCGGTCGTTATATAGATGTTTGCA 13 3 ATA 1 TTTATCGGTCGTTATATAGATGTTTGCA 14 3 TAT 1 TTTATCGGTCGTTATATAGATGTTTGCA 15 3 ATA 1 TTTATCGGTCGTTATATAGATGTTTGCA 17 3 AGA 1 TTTATCGGTCGTTATATAGATGTTTGCA 20 3 TGT 1 TTTATCGGTCGTTATATAGATGTTTGCA 22 3 TTT 1 TTTATCGGTCGTTATATAGATGTTTGCA 12 5 TATAT 1 TTTATCGGTCGTTATATAGATGTTTGCA 13 5 ATATA 1 TTTATCGGTCGTTATATAGATGTTTGCA 16 5 TAGAT 1 TTTATCGGTCGTTATATAGATGTTTGCA 21 5 GTTTG
    again works with any list passed as $ARGV[0] or with individual strings ala:
    # echo "TTTATCGGTCGTTATATAGATGTTTGCA" | perl -ne ...
    etc. and it does not match whitespace(s) as part of a reverse complementary match

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://515414]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others taking refuge in the Monastery: (8)
As of 2014-10-02 17:51 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    What is your favourite meta-syntactic variable name?














    Results (68 votes), past polls