Beefy Boxes and Bandwidth Generously Provided by pair Networks
laziness, impatience, and hubris

Re: stupid/simple mistake

by rnaeye (Pilgrim)
on Oct 18, 2011 at 17:02 UTC ( #932197=note: print w/replies, xml ) Need Help??

in reply to stupid/simple mistake

This works for me:

my $substring = 'GATC'; my$i=0; my$count; my $sequence; while ($sequence=<DATA>){ foreach($sequence =~ /($substring)/g) { print "$1\n"; $count++; } } print "There are $count negative numbers in the string\n"; __DATA__ GAGAGACCCCGATCGAGAGACCCGATCFGAGAVCTGATCCCC

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://932197]
and all is quiet...

How do I use this? | Other CB clients
Other Users?
Others lurking in the Monastery: (9)
As of 2017-06-28 12:37 GMT
Find Nodes?
    Voting Booth?
    How many monitors do you use while coding?

    Results (636 votes). Check out past polls.