Beefy Boxes and Bandwidth Generously Provided by pair Networks
Do you know where your variables are?
 
PerlMonks  

Re: rename FASTA

by Cristoforo (Deacon)
on Sep 19, 2012 at 22:10 UTC ( #994551=note: print w/ replies, xml ) Need Help??


in reply to rename FASTA

Using Bio::SeqIO, you can do something like this:

#!/usr/bin/perl use strict; use warnings; use Bio::SeqIO; my $in = Bio::SeqIO->new( -file => "fasta_junk.txt" , -format => 'fasta'); my $out = Bio::SeqIO->new( -file => '>o33.txt',#note the leading '>' -format => 'fasta'); my $i; while ( my $seq = $in->next_seq() ) { $seq->display_id(++$i); # set 'id' equal to 1, 2, ... $out->write_seq($seq); } __END__ *** fasta_junk.txt >GJKKTUG01DYDGC GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGCCAAC ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCAGCAG ACATGAGGAATACAAACTACAATCTTTTACTTGATGATGCAATGCCGGACAAACTCTAGA >F0Z7V0F01EDB3V AAGGCGAGNGGTATCACGCAGTAAGTTACGGTTTTCGGGTAACGCGTCNGNGGNACTAAC CCACGGNGGGTAACCCGTCNCTACCGGTATAGGACTAAGGTTACCGGAACGTCGTGGGGT ACCCCCCGGACGGGGACCGTCCCCTCATANAGTCAACNGTNTGAGATGGACTAACTCAAA CCTAGTTTCAAGTACTATTTAACTTACTTACGTTACCCGTAATTTCGGCGTTTAGAGGCG *** o33.txt >1 GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGCCAAC ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCAGCAG ACATGAGGAATACAAACTACAATCTTTTACTTGATGATGCAATGCCGGACAAACTCTAGA >2 AAGGCGAGNGGTATCACGCAGTAAGTTACGGTTTTCGGGTAACGCGTCNGNGGNACTAAC CCACGGNGGGTAACCCGTCNCTACCGGTATAGGACTAAGGTTACCGGAACGTCGTGGGGT ACCCCCCGGACGGGGACCGTCCCCTCATANAGTCAACNGTNTGAGATGGACTAACTCAAA CCTAGTTTCAAGTACTATTTAACTTACTTACGTTACCCGTAATTTCGGCGTTTAGAGGCG


Comment on Re: rename FASTA
Download Code
Re^2: rename FASTA
by naka (Initiate) on Sep 21, 2012 at 14:29 UTC
    Thank you very much. I'll try to lerning perl language. Regards

Log In?
Username:
Password:

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://994551]
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others imbibing at the Monastery: (10)
As of 2014-12-22 18:08 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    Is guessing a good strategy for surviving in the IT business?





    Results (126 votes), past polls