comment on

It helped both my coding style and efficiency, thank you! I have a question, if I only wanted to get the 3-triplet amino acid sequence for each start/stop sequence, and not translate it, I modified the code but can't figure out what I'm doing wrong. The string is passed to the while loop, the conditions are checked to terminate and match for the start of the substring, the substring is passed to the subroutine. Inside the subroutine, it enters a for loop, where it makes a substring $codon, if codon matches a regex termination pattern, it returns $dna_string. Here's the code:

#!/usr/bin/perl -w
use strict;

my $s1 = "AGCCATGTAGCTAACTCAGGTTACATGGGGATGACCCCGCGACTTGGATTAGAGTCTCTT
+";
print "$s1\n";

my $idx = -1;

my $start = 'ATG';

while (my $prefix = substr($s1, ++$idx, 3)) {
    last if length $prefix < 3;
    
    # check for start indicator
    next unless $prefix eq 'ATG';
    
    my $peptide = proteinseq(substr($s1, $idx));
    print "$peptide\n";
    }

sub proteinseq {
    my ($dna) = @_;
    
    my $dna_seq = '';
    for (my $i; $i < length($dna)-2; $i +=3) {
        my $codon = substr($dna, $i, 3);
        print "$codon\t";
        return $dna_seq if ($codon =~ /TA[GA]|TGA/);
        $dna_seq .= $codon;
    }
}
[download]

In reply to Re: A critique (was Re: Need help with code) by disulfidebond
in thread Need help with code by disulfidebond

Are you posting in the right place? Check out Where do I post X? to know for sure.
Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
<code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
Want more info? How to link or How to display code and escape characters are good places to start.


P is for Practical
	PerlMonks